Overview

Distribution

Range

Dry forests of South America east of the Andes to n Argentina.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melanerpes candidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACNTTACNTCATTTTTGGCGCATGAGCTGGCATAATCGGCACAGCCCTTAGCCTCCTCATTCGTGCTGAATTAGGCCAACCTGGCACCCTCCTCGGCGATGACCAAATTTATAACGTAATCGTCACTGCCCACGCATTCGTAATAATCTTCTTCATAGTCATACCCATCATAATTGGAGGATTCGGAAACTGGCTCGTCCCCCTTATAATTGGGGCCCCAGACATAGCATTCCCCCGAATAAACAACATGAGCTTCTGACTCCTTCCCCCATCATTCCTGCTCCTTCTAGCCTCCTCTACAGTAGAAGCAGGAGCCGGAACAGGATGAACTGTCTATCCACCCCTCGCCGGCAACCTAGCCCACGCAGGAGCTTCAGTAGACCTAGCCATTTTCTCCCTTCACCTAGCAGGTATTTCATCCATTTTAGGAGCAATCAATTTCATCACAACAGCCATCAACATAAAACCCCCAGCCATCTCTCAATACCAAACCCCCCTATTTGTCTGATCCGTCCTCATCACTGCCGTCCTCCTTCTCTTATCCCTCCCGGTCCTCGCCGCCGGTATTACAATACTTCTTACAGACCGCAACCTAAACACCACATTTTTTGATCCAGCCGGAGGAGGCGATCCAATCCTCTACCAACATCTCTTCTGATTCTTTGGCCACCCTGAAGTCTACATCCTTATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Melanerpes candidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'uncommon and patchily distributed' (Stotz et al. 1996).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White woodpecker

The white woodpecker (Melanerpes candidus) is a species of woodpecker (Family Picidae) found in South America. This woodpecker is a native of the grasslands of Brazil, Bolivia, Paraguay, Uruguay and Argentina.

This bird is particularly beneficial for citrus plantations because it consumes the irapuá bee, Trigona spinipes, a pest of citrus growers.

Description[edit]

White woodpecker at Weltvogelpark Walsrode, Germany

Besides being a bright white bird with deep black wings, the white woodpecker has a distinctive, small bright yellow eye patch.

Subspecies[edit]

No subspecies are known (monotypic).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!