Articles on this page are available in 2 other languages: Chinese (Simplified) (9), Dutch (1) (learn more)

Overview

Brief Summary

Eurasian jackdaws are true construction workers. They like to build their nests in cavaties, such as hollow trees, chimneys and roof gutters. Sometimes, a chimney is totally filled with branches in order to produce the desired nest. Such nests can be enormous. The top is always neatly finished with soft materials. Jackdaws are social and very intelligent birds. Pairs stay together their entire lives. They have adapted entirely to humans and eat whatever they can get hold of, from seeds to grains to French fries and cat kibble. They gather in large groups in the evening to sleep. You can hear them babbling from a far distance.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The jackdaw is a highly sociable species outside of the breeding season, occurring in flocks that can contain hundreds of birds (6). Within flocks there is a strict hierarchy, with a head bird (6). Occasionally the flock makes 'mercy killings', in which a sick or injured bird is mobbed until it is killed (6). The jackdaw typically feeds on the ground, taking insects and insect larvae, young birds, fruit and acorns (6). This is a playful species, performing aerobatics such as turning over in strong winds and diving; occasionally entire flocks may perform such displays at the same time (6). Males and females pair up in their first year of life, but they do not begin to breed for another year; the pair remains closely tied for life (6). Nests are usually constructed in some type of crevice, the pair drops sticks into the crevice until some become lodged; the nest is then built on this platform (6). This behaviour has often led to chimneys being blocked and even nests, with the jackdaw present, crashing down into fireplaces (4). The pair defend their nest vigorously against intruding jackdaws (6). 4-6 greenish-blue eggs are laid and incubated for up to 17 days by the female (6). Both parents feed the chicks for around 30 days (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The jackdaw is a lively, diminutive member of the crow family (5). It appears to have totally dark plumage from a distance, but on closer inspection it can be seen that it is dark grey in colour with a lighter grey nape and sides of the neck (2). The beak is short and slender, the eyes are a unique pale blue, and it walks with a quick 'jaunty' step (6), all of which allow this bird to be distinguished from the carrion and hooded crows or the rook (2). Males, females and juveniles are similar in appearance (2). The name 'daw' for this bird has been used since the 15th century; it is probably imitative of the call (4), but also means 'simpleton' (6). 'Jack' is often used for small animals, and, like knave, means rogue, yet it may also be derived from another call, 'tchack' (6). This bird is indeed smaller than both the rook and the carrion crow, and is a renowned thief (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Widely distributed throughout Britain, but scarcer in upland areas (5). It is also widespread throughout western Europe (6). Scandinavian populations migrate to England, Scotland and the Low Countries for the winter (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.546 - 10.708
  Nitrate (umol/L): 2.813 - 12.829
  Salinity (PPS): 32.748 - 34.935
  Oxygen (ml/l): 6.360 - 6.665
  Phosphate (umol/l): 0.371 - 0.734
  Silicate (umol/l): 1.816 - 8.436

Graphical representation

Temperature range (°C): 9.546 - 10.708

Nitrate (umol/L): 2.813 - 12.829

Salinity (PPS): 32.748 - 34.935

Oxygen (ml/l): 6.360 - 6.665

Phosphate (umol/l): 0.371 - 0.734

Silicate (umol/l): 1.816 - 8.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.546 - 10.708
  Nitrate (umol/L): 2.813 - 12.829
  Salinity (PPS): 32.748 - 34.935
  Oxygen (ml/l): 6.360 - 6.665
  Phosphate (umol/l): 0.371 - 0.734
  Silicate (umol/l): 1.816 - 8.436

Graphical representation

Temperature range (°C): 9.546 - 10.708

Nitrate (umol/L): 2.813 - 12.829

Salinity (PPS): 32.748 - 34.935

Oxygen (ml/l): 6.360 - 6.665

Phosphate (umol/l): 0.371 - 0.734

Silicate (umol/l): 1.816 - 8.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in buildings and cavities in houses, as well as in parks, woodlands with hollow trees, and on sea cliffs (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Recent research (von Bayern and Emery 2009) suggests that jackdaws can follow eye-signals from people. Researchers propose that this ability evolved in the context of learning the location of hidden food from conspecifics.

Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Cyndy Parr

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corvus monedula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTTATCCGAGCAGAACTAGGACAACCAGGTGCTCTTCTAGGAGACGACCAAATCTATAATGTAATTGTTACAGCCCATGCTTTCGTCATAATCTTCTTCATAGTAATGCCAATTATAATCGGGGGATTCGGAAACTGACTAGTTCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCTCCCTCATTCCTTCTTCTTCTAGCCTCTTCTACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTATACCCACCACTAGCTGGTAATATAGCCCACGCCGGAGCCTCAGTCGACCTAGCTATCTTCTCACTACACCTAGCAGGTATTTCCTCAATCCTAGGGGCAATTAACTTTATTACTACAGCAATCAACATAAAACCTCCAGCTCTATCACAATACCAAACCCCTCTGTTCGTATGATCCGTACTAATTACCGCAGTACTACTCCTTCTATCTCTACCTGTACTTGCTGCCGGGATTACCATGCTACTAACAGACCGAAACCTCAATACCACATTCTTCGATCCAGCAGGAGGAGGAGACCCAGTACTATACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Corvus monedula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5