Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Comprehensive Description

Longueur 45-57 cm, envergure 64-68 cm, poids 290-370 g.

Il apprécie les hautes futaies âgées, notamment les hêtraies-sapinières et les hêtraies pures. Il peut vivre également parmi les mélèzes, épicéas et autres conifères ou feuillus, de préférence bien espacés et sur de grandes surfaces. Il s’installe aussi dans les petites forêts séparées des grands massifs par quelques kilomètres.

Le Pic noir se nourrit surtout des larves, pupes et adultes de fourmis et de coléoptères xylophages. Son bec est plus grand et plus fort que celui des autres pics européens, mais sa langue se projette plus faiblement (50-55 mm au-delà de la pointe du bec) que celle du Pic vert. Ses larges glandes salivaires produisent une sécrétion visqueuse qui couvre la langue, dont la pointe est garnie de barbillons orientés vers l’arrière. Ils lui permettent d’empaler et d’extraire les larves de coléoptères.

L’espèce est solitaire. Mâle et femelle ont des territoires séparés ou se chevauchant en période internuptiale. La formation du couple débute tôt, la sélection du site et l’excavation du trou de nid commençant dès la mi-février. Dans la plupart des cas, le couple n’est uni que pour une seule saison, de l’hiver à l’été. Les oiseaux âgés restent fidèles à un territoire et à certains arbres à cavités. Les territoires sont très grands, souvent de l’ordre de 300-400 ha pour un couple, parfois moins de 100 ha dans les habitats les plus favorables.

La ponte unique de 4-6 œufs (extrêmes : 1-9) est déposée à partir d’avril dans une cavité creusée dans un arbre. La hauteur du trou varie de 4 à 25 m. L’entrée est ovale et d’une profondeur atteignant 60 cm. Il n’y a aucune garniture hormis d’éventuels copeaux non évacués. L’incubation dure 12 jours et l’envol a lieu à l’âge de 24-28 jours.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 14 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dryocopus martius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACCCTATATCTTATCTTCGGCGCATGGGCTGGCATAATCGGTACAGCCCTCAGCCTCCTCATTCGTGCCGAACTGGGCCAACCTGGTACCCTCCTCGGCGACGACCAGATCTACAACGTCATCGTCACTGCCCACGCATTTGTAATAATCTTTTTCATAGTTATACCAATCATGATCGGCGGATTTGGAAACTGACTCGTACCACTTATAATCGGAGCCCCTGACATAGCATTCCCACGGATAAACAACATAAGCTTCTGACTCCTCCCACCGTCCTTCCTACTCCTTCTAGCCTCCTCCACAGTAGAAGCTGGAGCAGGAACAGGCTGAACTGTCTACCCCCCTCTTGCAGGCAACCTAGCCCACGCAGGGGCCTCAGTAGACCTAGCTATCTTCTCACTACACCTAGCAGGTATCTCATCCATCCTTGGAGCAATCAACTTTATTACCACAGCCATCAACATAAAACCCCCAGCCATCTCACAATATCAAACTCCCCTATTTGTCTGATCCGTCCTCATCACTGCCGTCCTTCTTCTCCTATCCCTCCCGGTCCTCGCCGCCGGCATCACAATACTCCTCACAGATCGAAACCTGAACACCACATTCTTCGACCCTGCCGGAGGGGGCGACCCGATCCTCTACCAACACCTCTTCTGATTCTTCGGCCATCCCGAAGTCTACATCCTTATCCTTCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dryocopus martius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5