Articles on this page are available in 1 other language: Spanish (17) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dryocopus lineatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTCTCCACCAACCACAAGGACATTGGCACTTTATATCTTATCTTTGGCGCATGAGCCGGCATAATCGGCACAGCCCTTAGCCTCCTTATCCGCGCTGAACTAGGCCAACCTGGCACCCTCCTCGGCGAC---GATCAAATCTACAACGTCATCGTTACCGCCCACGCATTCGTAATAATCTTCTTCATAGTCATACCCATCATGATCGGCGGATTTGGAAACTGACTCGTACCACTCATAATCGGAGCCCCCGACATAGCATTCCCACGAATGAACAATATAAGCTTCTGACTCCTCCCACCATCATTCCTACTCCTCCTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGAACAGGCTGAACCGTCTACCCACCCCTCGCTGGCAACCTAGCCCACGCGGGAGCTTCAGTGGACCTAGCCATCTTCTCACTCCACCTGGCAGGTATCTCATCCATCCTTGGGGCAATCAACTTTATTACCACAGGCATCAACATAAAACCCCCAGNCATTTCACAATACCAAACCCCCCTATTTGTCTGATCCGTCCTCATCACCGCCGTCCTCCTCCTCCTATCCCTCCCAGTCCTCGCCGCTGGCATCACGATGCTCCTCACAGACCGCAACCTGAACACTACATTCTTTGACCCTGCAGGAGGGGGCGACCCAATCCTCTACCAACATCTCTTCTGATTTTTCGGCCACCCCGAAGTTTACATCCTCATCCTACCTGGATTTGGCATGATCTCCCACGTAGTGACCTACTACGCCGGCAAAAAAGAACCCTTCGGCTACATGCCAATAGTATGAGCCATACTATCTATTGGATTCCTTGGCTTTATCGTATGGGCTCACCACATATTCACCGTAGGAATAGNCGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dryocopus lineatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight (A. Panjabi in litt. 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lineated Woodpecker

The Lineated Woodpecker (Dryocopus lineatus) is a very large woodpecker which is a resident breeding bird from Mexico south to northern Argentina and on Trinidad.

Contents

Description

Note narrow face stripe

The Lineated Woodpecker is 31.5 to 36 centimetres (12.4 to 14 in) long. It resembles the closely related Pileated Woodpecker (Dryocopus pileatus) of United States and Canada.

Adults are mainly black above, with a red crest and whitish lines from the base of the bill, down the neck and shoulders (though individuals from the south-eastern part of its range commonly lack the line on the shoulders). The underparts are whitish, heavily barred with black. They show white on the wings in flight. Adult males have a red line from the bill to the throat (malar) and a red forehead. In adult females, these plumage features are black. The bill is typically black in both sexes, though pale-billed individuals regularly are seen.

The call of this widespread but wary bird is a loud, ringing wic-wic-wic. Both sexes drum.

In most of its range, it is most likely confused with the Crimson-crested Woodpecker (Campephilus melanoleucos), which has a similar plumage and size. In the female of that species, the light face line is far broader, and the white shoulder lines meet on the back lower back (forming a "V"). The male Crimson-crested Woodpecker is quite different with its almost entirely red head.

Subspecies

D. l. scapularis (Vigors, 1829) – western Mexico (Sonora south to Guerrero). The white stripe on the sides of the face is reduced or lacking; also smaller than similis and nominate lineatus. Bill pale, pale horn, dull white, or bluish white.

D. l. similis (Lesson, 1847) – eastern and southern Mexico south to northwestern Costa Rica. Bill pale, pale horn, dull white, or bluish white. Underparts buffy. Body mass is 136–181 g (4.8–6.4 oz).

D. l. lineatus (Linnaeus, 1766) – eastern and southern Costa Rica south to western Colombia and east to Trinidad, the Guianas and northeastern and eastern Brazil (Maranhão, Bahia), and south to eastern Peru, northern Paraguay and south central Brazil (São Paulo). Bill dark. Body mass is 186–228 g (6.6–8.0 oz).

D. l. fuscipennis (P. L. Sclater, 1860) – western Ecuador and northwestern Peru. Bill dark. Smaller than nominate lineatus. Plumage browner, less black.

D. l. erythrops (Valenciennes, 1826) – eastern Paraguay, northern and northeastern Argentina and southeastern Brazil. Bill dark. Larger than nominate. White scapular lines often reduced; generally the scapular lines are absent in southern populations, but the "proportion of individuals with scapular lines increases towards range of nominate lineatus" (Winkler et al., 1995). Body mass is 216–264 g (7.6–9.3 oz).

Ecology

The habitat of this species is forest borders and other open woodland. It is not generally a mountain bird, though it has occasionally been recorded in the uplands (e.g., in the Serranía de las Quinchas of Colombia[2]) Three white eggs are laid in a nest hole is in a dead tree and incubated by both sexes. The young are fed by regurgitation.

Lineated Woodpeckers chip out holes, often quite large, while searching out insects in trees. They mainly eat insects, especially ants, beetles and their larvae, with some seeds, such as from Heliconia, and fruits, berries, and nuts.

Lineated Woodpeckers breed March–April in Panama, April–May in Belize, and February–April in Trinidad and Suriname. Nest cavities are excavated in dead trees at variable heights, from 2–27 m above the ground. Both sexes excavate the nests, which are about 45 cm deep, 13 x 18 cm wide, and have an entrance about 9 cm in diameter. Clutch size ranges from 2–4 eggs (2–3 in Trinidad). Males and females take 2–3 hour shifts incubating during the day, but only males incubate at night. Chicks are fed about once an hour by both parents through regurgitation; the female does most of the feeding while the male guards the nest. Incubation and fledging periods not documented.[3]

References

  1. ^ BirdLife International (2012). "Dryocopus lineatus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Cuervo, Andrés M.; Hernández-Jaramillo, Alejandro; Cortés-Herrera, José Oswaldo & Laverde, Oscar (2007): Nuevos registros de aves en la parte alta de la Serranía de las Quinchas, Magdalena medio, Colombia [New bird records from the highlands of Serranía de las Quinchas, middle Magdalena valley, Colombia]. Ornitología Colombiana 5: 94–98 [Spanish with English abstract]. PDF fulltext
  3. ^ http://neotropical.birds.cornell.edu/portal/species/conservation?p_p_spp=320376
  • ffrench, Richard; O'Neill, John Patton & Eckelberry, Don R. (1991): A guide to the birds of Trinidad and Tobago (2nd edition). Comstock Publishing, Ithaca, N.Y. ISBN 0-8014-9792-2
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!