Articles on this page are available in 2 other languages: Chinese (Simplified) (10), Dutch (1) (learn more)

Overview

Brief Summary

Magpies have the reputation for eating lots of eggs and young birds. Although they do like eggs, this is only a small part of their diet. Nor is the number of songbirds declining due to them. Magpies like large insects the most, followed by berries and seeds. They build their nests high up in trees early in spring. The nest is an ingenious construction made from branches. The nests have a roof, making it much taller than a crow's nest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

This much maligned bird is widely disliked because of its feeding habits; magpies occasionally take bird eggs and chicks, small mammals and even adders (6). Yet they are often beneficial birds, perching on livestock and ridding them of ticks, and feeding mainly on pest insects (6), other invertebrates and vegetable matter (7). Magpies hoard food in holes in the ground during winter (7). They are notorious thieves, taking clothes pegs and other brightly coloured objects from gardens (6). Magpies are sociable birds, gathering in groups to roost, and occasionally forming noisy gatherings called 'magpie parliaments' (4) in the first few weeks of the year. It is thought that these gatherings are 'crow marriages', which allow unpaired birds to find a mate before the approaching breeding season (6). During spring, territories are defended, and fights may ensue. Both sexes help to construct the large roofed nest; the male brings nesting material while the female arranges it. 5-7 eggs are laid in April or May, and incubated for up to 18 days (6). After hatching, the chicks stay in the nest for 22-27 days, and rely on their parents for food for up to 8 weeks after leaving the nest. The fledglings stay with their parents throughout autumn and winter (6). There are many folk stories involving the magpie; it is thought to be associated with the devil in many parts of the country, and crossing oneself upon seeing one or saluting lone magpies is a practice that continues to this day in some areas. The magpie rhyme varies greatly, but usually begins: one for sorrow, two for joy (4). It is believed that the magpie refused to mourn Christ at the crucifixion, it is also said that the magpie refused to enter Noah's ark, instead sitting on the roof and swearing for the duration of the deluge (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The common magpie is an unmistakable species with its black and white plumage, and iridescent green or blue glossy sheen (2). The tail is long, and is usually longer in males than females (2). Its harsh voice includes a fast chattering alarm call; the 'mag' part of the common name used to mean 'chatterer' (4), and was added to 'pie' (referring to the black and white 'pied' colouring) in the 16th century (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description of Pica pica

De \'\'Ekster\'\' (\'Pica pica\') is een vogel die behoort tot de familie van kraaiachtigen. ==Verschijning en gewoonten== Met zijn opvallende zwart-witte verenkleed is de ekster een van de gemakkelijkst te herkennen vogels. De vogel is meestal in bomen te vinden, waar hij ook zijn grote nest in bouwt van takken. Zoals alle kraaiachtigen is de ekster een omnivoor die vooral in het voorjaar nesten van andere vogels leegrooft; de aanwezigheid van eksters gaat dan ook meestal met veel alarm van andere vogels gepaard.  Eksters 46 cm. Gemakkelijk herkenbaar door contrasterend zwart en wit verenkleed en lange staart, die de helft van lichaamslengte uitmaakt. Staart van mannetje langer dan van vrouwtje. Flanken, buik en schouders puur wit; rest van verenkleed, snavel en poten zwart. Staart- en vleugelveren met opvallende metaalachtige glans, vooral in zonlicht. Juveniel lijkt sterk op adult, maar heeft kortere staart. Houdt van kleurige en glimmende voorwerpen, welke naar het nest gebracht worden.
Creative Commons Attribution 3.0 (CC BY 3.0)

Quest

Source: BioPedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Various races of the magpie Pica pica occur throughout Europe and Asia, reaching as far south as the Mediterranean and the Himalayas (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in a broad range of habitats (7), but tends to breed around farms and villages and in urban areas (2) where there are trees, shrubs and open areas (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Pica pica preys on:
Agelaius phoeniceus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 21.7 years (wild) Observations: Oldest banded individual was 21.7 years-old (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pica pica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTTCTTATCCGAGCAGAACTAGGCCAACCCGGTGCCCTGCTAGGAGACGACCAAATCTACAATGTTATCGTTACAGCTCATGCTTTCGTCATAATCTTCTTCATAGTAATACCAATTATGATCGGAGGGTTCGGAAACTGACTAGTACCCCTAATAATTGGTGCCCCGGACATAGCCTTCCCACGAATAAACAATATAAGCTTCTGACTTCTTCCTCCCTCATTCCTTCTCCTACTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGCACAGGATGAACCGTATATCCCCCACTAGCTGGTAACCTAGCCCATGCTGGGGCTTCAGTAGACCTAGCCATTTTCTCACTACATCTAGCAGGTATCTCATCTATTCTAGGGGCAATCAACTTCATCACCACAGCAATTAATATAAAACCCCCAGCACTATCACAATATCAAACTCCTCTATTTGTATGATCCGTACTAATCACCGCAGTACTGCTTCTTCTATCCCTTCCTGTCCTTGCCGCTGGAATTACTATGCTCCTAACAGACCGTAACCTTAACACTACATTCTTCGATCCAGCAGGAGGAGGAGACCCAGTACTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pica pica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act 1981 (3), but can be trapped, shot or their eggs and nests destroyed under the terms of General Licences issued by government (9). Included in the Birds of Conservation Concern Green List (low conservation concern) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Rich et al. (2004) estimated the global population to number 3,400,000 individuals. In Europe, the breeding population is estimated to number 7,500,000-19,000,000 breeding pairs, equating to 22,500,000-57,000,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 45,900,000-228,000,000 individuals, although further validation of this estimate is needed. National population estimates include: c.10,000-100,000 breeding pairs in China; c.100-100,000 introduced breeding pairs in Taiwan; c.10,000-100,000 breeding pairs in Korea; c.100-10,000 breeding pairs (possibly introduced) in Japan and c.10,000-100,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This common species is not threatened in Great Britain.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

No conservation action is targeted at this species, but it receives general protection under the Wildlife and Countryside Act 1981 (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurasian magpie

The Eurasian magpie, European magpie, or common magpie (Pica pica) is a resident breeding bird throughout Europe, much of Asia and northwest Africa. It is one of several birds in the crow family named as magpies, and belongs to the Holarctic radiation of "monochrome" magpies. In Europe, "magpie" is used by English speakers as a synonym for the European magpie; it is the only magpie in Europe outside the Iberian Peninsula.

The Eurasian magpie is one of the most intelligent birds, and it is believed to be one of the most intelligent of all animals.[2] The expansion of its nidopallium is approximately the same in its relative size as is found in chimpanzees, orangutans and humans.[3]

Taxonomy and systematics[edit]

Maghreb magpie (P. p. mauretanica), Marrakech, Morocco

There are numerous subspecies. The northwest African race differs in having a patch of blue bare skin around the eye, no white patch on the rump and an unglossed tail. The southwest Arabian race differs in being smaller, with dull black plumage lacking iridescent tones, and minimal white in the wings. The Siberian races have more extensive white in the wings, and brilliant green iridescence; Korean birds have a purple gloss instead and relatively longer wings and a shorter tail.

Analysis of mtDNA sequences[4] has indicated that the Korean race, P. pica sericea, is very distinct from the other Eurasian forms, and may be a separate species. The North American black-billed magpie which looks almost identical to the Eurasian form and was previously considered conspecific is genetically closer to the yellow-billed magpie. The main Eurasian lineages of this astoundingly variable species have not been sufficiently sampled to clarify the status of such forms as the northwest African race, Maghreb magpie (P. p. mauretanica) and the southwest Arabian race P. p. asirensis, which could also be distinct species.

A larger palaeosubspecies of the European magpie was described as Pica pica major.

Etymology[edit]

The common name comes from magot pie (pied Margot), first found[5] in Shakespeare's Macbeth.[6] The scientific name Pica is just the Latin word for magpie.[7] When Linnaeus first described this species in 1758, he named it Corvus pica.[8]

Description[edit]

The Eurasian magpie is 44–46 centimetres (17–18 in) in length—in the adult over 50% of this is tail—and a wingspan of 52–62 centimetres (20–24 in).[9] Its head, neck and breast are glossy black with a metallic green and violet sheen; the belly and scapulars (shoulder feathers) are pure white; the wings are black glossed with green or purple, and the primaries have white inner webs, conspicuous when the wing is open. The graduated tail is black, shot with bronze-green and other iridescent colours. The legs and bill are black.

The young resemble the adults, but are at first without much of the gloss on the sooty plumage. The male is slightly larger than the female.[9]

Behaviour and ecology[edit]

In flight

The Eurasian magpie is a distinctive species with pied plumage, long 20–30 centimetres (8–12 in) graduated tail, and loud chatter. When passing in open country they rapidly move their wings and chatter. Upon landing the long tail is elevated and carefully carried clear of the ground.

Like other corvids such as crows, the magpie usually walks, but can also hop quickly sideways with wings slightly opened.

The magpie is omnivorous, eating young birds and eggs, insects, scraps and carrion, acorns, grain, and other vegetable substances.

In Turtuk Village, Ladakh

Magpies are common in suburban areas[10] but tend toward shyness and caution in the country. They only avoid humans when harassed.

Young bird

In winter, magpies often form groups, feeding and roosting at night.

Reproduction[edit]

Magpies are territorial and stay in their own all year, even in the north of the species range. The pairs are monogamous and remain together for life, finding new partners from the stock of yearlings if one is lost.

Mating takes place in spring. In the courtship display males rapidly raise and depress their head feathers, uplift, open and close their tails like fans, and call in soft tones quite distinct from their usual chatter. The loose feathers of the flanks are brought over the primaries, and the shoulder patch is spread so the white is conspicuous, presumably to attract females. Short buoyant flights and chases follow.

Egg

Magpies prefer tall trees for their bulky nest, firmly attaching them to a central fork in the upper branches. A framework of the sticks is cemented with earth and clay, and a lining of the same is covered with fine roots. Above is a stout though loosely built dome of prickly branches with a single well-concealed entrance. These huge nests are conspicuous when the leaves fall. Where trees are scarce, though even in well-wooded country, nests are at times built in bushes and hedgerows.

Eggs are typically laid in April, five to eight is normal though as many as ten have been recorded. Small for the size of the bird, they are typically blue-green with close specks and spots of brown and grey, but show much variation in ground and marking. Only one brood is reared unless disaster overtakes the first clutch.

Intelligence[edit]

The Eurasian magpie is believed not only to be among the brightest of birds but among the most intelligent of all animals. Along with the jackdaw, the Eurasian magpie's nidopallium is approximately the same relative size as those in chimpanzees and humans, significantly larger than the gibbon's.[3] Like other corvids, such as ravens and crows, their total brain-to-body mass ratio is equal to most great apes' and cetaceans.'[11]

Magpies have been observed engaging in elaborate social rituals, possibly including the expression of grief.[12] Mirror self-recognition has been demonstrated in European magpies,[13] making them one of but a few species and the only non-mammal known to possess this capability.[14] The cognitive abilities of the Eurasian magpie are regarded as evidence that intelligence evolved independently in both corvids and primates. This is indicated by tool use, an ability to hide and store food across seasons, episodic memory, using their own experience to predict the behavior of conspecifics.[2] Another behavior exhibiting intelligence is cutting their food in correctly sized proportions for the size of their young. In captivity magpies have been observed counting up to get food, imitating human voices, and regularly using tools to clean their own cages.[citation needed] In the wild, they organise themselves into gangs and use complex strategies hunting other birds and when confronted by predators.[15]

Relationship with humans[edit]

Traditions[edit]

In European folklore the magpie is associated with a number of superstitions[16] surrounding its reputation as an omen of ill fortune. In the 19th century book, A Guide to the Scientific Knowledge of Things Familiar, a proverb concerning magpies is recited: "A single magpie in spring, foul weather will bring". The book further explains that this superstition arises from the habits of pairs of magpies to forage together only when the weather is fine. In Scotland, a magpie near the window of the house is said to foretell death.[17]

Hopscotch game with the magpie rhyme

In both Italian and French folklore, magpies' are believed to have a penchant for picking up shiny items, particularly precious stones. Rossini's opera La gazza ladra and The Adventures of Tintin comic The Castafiore Emerald are based on this theme. In Bulgarian, Czech, German, Hungarian, Polish, Slovak and Swedish folklore the magpie is also seen as a thief. In Sweden it is further associated with witchcraft.[18] In Norway, a magpie is considered cunning and thievish too, but also the bird of huldra, the underground people.[19]

In the British Isles a widespread traditional rhyme, One for Sorrow, records the myth (it is not clear whether it has been seriously believed) that seeing magpies predicts the future, depending on how many are seen. There are many regional variations on the rhyme, which means that it is impossible to give a definitive version.[20][21]

See also[edit]

References[edit]

  1. ^ BirdLife International (2012). "Pica pica". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Prior H. et al. (2008). De Waal, Frans, ed. "Mirror-Induced Behavior in the Magpie (Pica pica): Evidence of Self-Recognition". PLoS Biology (Public Library of Science) 6 (8): e202. doi:10.1371/journal.pbio.0060202. PMC 2517622. PMID 18715117. Retrieved 2008-08-21. 
  3. ^ a b Comparative vertebrate cognition: are primates superior to non-primates?, By Lesley J. Rogers, Gisela T. Kaplan, page 9, Springer, 2004
  4. ^ Lee et al., 2003
  5. ^ Lockwood, W B (1993). The Oxford Dictionary of British Bird Names. OUP. ISBN 978-0198661962. 
  6. ^ "Shakespeare Search". rhymezone.com. Retrieved 10 May 2010. 
  7. ^ Jobling, James A (1991). A Dictionary of Scientific Bird Names. OUP. ISBN 0 19 854634 3. 
  8. ^ Carl Linnaeus (1758). Systema Naturæ (10 ed.). p. 106. Retrieved 9 November 2010. 
  9. ^ a b The Birds of the Western Palearctic [Abridged]. OUP. 1997. ISBN 019854099X. 
  10. ^ Leszek, Jerzak (2001). Synurbanization of the magpie in the Palearctic. W: Avian ecology and conservation in an urbanizing world. Boston:Kluwer Academic Publishers, p. 403–425. ISBN 0-7923-7458-4.
  11. ^ Birding in India and South Asia: Corvidae. Retrieved 2007-NOV-10
  12. ^ Animal emotions, wild justice and why they matter: Grieving magpies, a pissy baboon, and empathic elephants, M Bekoff - Emotion, Space and Society, 2009 - Elsevier
  13. ^ Frans de Waal, The Age of Empathy: Nature's Lessons for a Kinder Society (New York: Harmony Books, 2009), 149.
  14. ^ Prior, Schwarz, and Güntürkün, Helmut, Ariane, and Onur; Schwarz, A; Güntürkün, O; De Waal, Frans (2008). De Waal, Frans, ed. "Mirror-Induced Behavior in the Magpie (Pica pica): Evidence of Self-Recognition". PLoS Biology (Public Library of Science) 6 (8): e202. doi:10.1371/journal.pbio.0060202. PMC 2517622. PMID 18715117. Retrieved 2008-08-21. 
  15. ^ Meet the Magpie, (AuthorHouse, 2010) By Joyce Robertson, page 5
  16. ^ Tickner, Lisa (1980). "One for Sorrow, Two for Mirth: The Performance Work of Rose Finn-Kelcey". Oxford Art J 3 (1): 58–73. doi:10.1093/oxartj/3.1.58 (inactive 2012-01-05). 
  17. ^ Brewer, E. C. (1970); p. 674
  18. ^ Brewer (1970); p. 674
  19. ^ store norske leksikon; http://snl.no/skj%C3%A6re/folketro
  20. ^ Brewer, E. C. (1970) Brewer's Dictionary of Phrase and Fable; centenary ed., rev. by Ivor H. Evans. London: Cassell; p. 674
  21. ^ Opie, Iona & Peter (1959) The Lore and Language of Schoolchildren. Oxford: Clarendon Press; p. 217

Cited texts[edit]

  • Lee, Sang-im; Parr, Cynthia S.; Hwang, Youna; Mindell, David P. & Choe, J. C. (2003). Phylogeny of magpies (genus Pica) inferred from mtDNA data. Molecular Phylogenetics and Evolution 29: 250-257. doi:10.1016/S1055-7903(03)00096-4 PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!