Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: RESIDENT: from Nayarit, Nuevo Leon, and southern Texas south to Honduras, also in South America (mountains and foothills of northern Venezuela east to Sucre) and Andes of western Venezuela, Colombia, eastern Ecuador, eastern Peru, and northwestern Bolivia (La Paz and Cochabamba); Perija Mountains on Venezuela-Colombia border (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

There are two distinct populations of the Green Jay. The first is found north of the Rio Grande river in southern Texas to north central Honduras. The second population stretches from Colombia and Venezuela south through eastern Ecuador and Peru to Bolivia.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Green Jay is a long-tailed bird with a short crest. It is similar in size to a Blue Jay. Its wings, however, are shorter and more rounded. The Texas Green Jay has stiff, short deep blue nasal and frontal plumes. Its forehead, crown, and nape are white to bluish white. The feathers of the mantle, back, rump, and uppertail-coverts are deep green and sometimes tinged with blue. The breast and remaining underparts are yellow to yellow-green. Individuals from South America are a little larger and with longer nasal and frontal plumes that form a bushy crest.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 27 cm

Weight: 100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Humid forest, forest edge, dense second growth, evergreen dry subtropical forest, clearings, plantations, pine-oak association, and less commonly, open situations with scattered trees. Visits towns, ranches, and open country in winter. Tolerates good deal of habitat disturbance (Ridgely and Tudor 1989). BREEDING: Nests in well-hidden site in thicker shrubs and trees, often low, usually at 1.5-4.5 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Texas Green Jay prefers open woodland, dense secondary growth, and bushy thickets dominated by mesquite. This jay is also found in citrus groves. Middle American populations prefer humid forests, rain forests, lowlands, plantations, and mountains. In South America the Green Jay is found in humid montane forest and forest borders, clearings, and secondary woodland.

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats insects and spiders, seeds, grains, and fruits (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Green jays are omnivorous. Their basic diet consists of arthropods, vertebrates, seeds, and fruit. The bird forages in family flocks by examining new surroundings after hopping or short flights. When foraging, the bird moves from the lower portion of a tree in a spiral fashion up to the branches. The jay ocassionally hovers to inspect slender branches and clumps of moss. When foraging on the ground as an individual, it turns over dry leaves and twigs by sweeping its bill from side to side.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Yearlings provide significant amount of territorial defense of their parents' nesting territory. In Texas, group size 6-9 (mostly family members); territory size 14-19 ha (Gayou 1986). Groups of 3-9 on permanent territories in Colombia (Hilty and Brown 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
139 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, though they have been reported to live up to 11.6 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm). Considering the longevity of similar species, maximum longevity could be significantly underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eggs laid April-May in north (Texas). Clutch size 3-5 (commonly 4). Incubation 15-17 days, by female. Young tended by both parents, leave nest at 19 days; stay in family flock for 1 year, until young of following year fledge (Gayou 1986). Each flock has a breeding pair and helpers (Hilty and Brown 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Green Jay practices monogamy, and pairs may form at any time during the year through the replacentment of an absent breeder. During the breeding season, a breeding pair rarely parts. Nests are usually in dense thickets, and trees and bushy shrubs are common nesting sites. Both the male and the female participate equally in choosing the nest site and building the nest. In Colombia, other members of a flock have occassionally been seen to participate in constructing the nest. The nest is cupped and its thin walls enable the eggs inside to be seen from below. Green Jay nests are constructed of thorny twigs and sticks and lined with roots, stems, moss, or dry leaves. Average clutch size is four grayish-white oval eggs. Incubation is performed only by the female and lasts 17 days. In Texas populations, the female is fed by the male at least six times a day. In South American populations, the female is fed by her mate; however, during the last three days of incubation she is fed by other flock members. After the chicks have hatched, the male continues to bring food to the nest for five days, then both parents share equally in bringing food to the chicks. Once the chicksd leave the nest, the female continues to feed them for three weeks. In Columbian flocks, all members cooperate in bringing food to the young and continue feeding the chicks for at least 20 days after they leave the nest.

Average eggs per season: 4.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyanocorax yncas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCATCCTTATCCGAGCAGAACTAGGCCAACCTGGTTCTCTACTAGGAGATGACCAGATCTACAATGTAGTCGTTACAGCTCACGCTTTCGTCATAATCTTCTTCATAGTAATACCAATCATAATCGGAGGATTTGGAAACTGACTAGTGCCACTAATAATCGGAGCTCCAGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTTCTCCCTCCATCATTCCTTCTTCTCCTAGCTTCCTCAACAGTAGAAGCAGGAGTAGGAACAGGATGAACTGTGTACCCCCCACTAGCCGGTAACCTGGCCCACGCCGGAGCTTCAGTTGACCTGGCTATCTTCTCACTACATCTAGCAGGTATCTCCTCTATCCTAGGAGCAATCAACTTCATTACCACAGCAATCAATATAAAACCACCAGCTCTATCACAATATCAAACCCCCCTGTTCGTATGATCTGTCCTAATTACTGCAGTACTACTTCTTCTTTCTCTTCCAGTTCTAGCTGCTGGAATTACTATGCTCCTAACAGACCGCAATCTCAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAGTACTATACCAGCACCTATTCTGATTCTTCGGTCATCCAGAAGTCTACATCCTGATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyanocorax yncas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Green Jay holds no special status, but populations are limited by the amount of breeding habitat available. The bird is also vulnerable to traps set for other animals. The effects of trapping can be can be reduced by closing the traps at dusk or checking them at frequent intervals.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

--

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

--

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Green jay

The green jay (Cyanocorax yncas) is a bird species of the New World jays, and is found in both North and South America.

Description[edit]

Green jays are 25–29 cm (10–11.5 in). Weight ranges from 66 to 110 grams (2.3–3.9 oz).[2] They have feathers of yellowish-white with blue tips on the top of the head, cheeks and nape, though some taxa have more blue than others. The breast and underparts range from bright yellow in the south to pale green in the north (e.g., Texas). The upper parts are rich green. It has large nasal bristles that form a distinct tuft in some subspecies, but are less developed in others. The color of the iris ranges from dark brownish to bright yellow depending on the subspecies.

Taxonomy[edit]

Usually lumped with Inca jay (C. yncas yncas) of South America; Somewhat confusing in classification, the green jay is then used as the species name, even though the inca jay it is nominate subspecies. [3][4]

Behavior[edit]

Green jays feed on a wide range of insects and other invertebrates and various cereal grains. They take ebony (Ebenopsis spp.) seeds where these occur, and also any oak species' acorns, which they will cache. Meat and human scraps add to the diet when opportunity arises. Green jays have been observed using sticks as tools to extract insects from tree bark.[5]

Breeding[edit]

Green jays usually build a nest in a tree or in a thorny bush or thicket, and the female lays three to five eggs. Only the female incubates, but both parents take care of the young.[2]

Feeding[edit]

Their basic diet consists of arthropods, vertebrates, seeds, and fruit.

Voice[edit]

As with most of the typical jays, this species has a very extensive voice repertoire. The bird's most common call makes a rassh-rassh-rassh sound, but many other unusual notes also occur. One of the most distinctive calls sounds like an alarm bell.

Distribution and habitat[edit]

The green jay group occurs From southern Texas to Honduras. The inca jay subspecies then have a disjunct home range in the northern Andes in South America.

References[edit]

  1. ^ BirdLife International (2012). "Cyanocorax luxosus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Green Jay, Life History, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2013-03-30.
  3. ^ Ridgely, R. S.; & Greenfield, P. J. (2001). The Birds of Ecuador – Field Guide. Cornell University Press. ISBN 0-8014-8721-8
  4. ^ Hilty, S. L. (2003). Birds of Venezuela. Princeton University Press. ISBN 0-691-02131-7
  5. ^ "Tool use by Green Jays" (PDF). Wilson Bulletin 94 (4): 593–594. 1982. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Distinctive Middle American group sometimes has been treated as a species, C. LUXUOSUS, separate from South American C. YNCUS. Sometimes treated in genus XANTHOURA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!