Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus subterraneus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGTTTTGGAAATTATTTAATTCCATTAATAATTGGATCTCCGGATATAGCTTTTCCTCGAATAAATAATATTAGATTTTGAATTCTTCCTCCTTCATTAATTATATTATTATTAAGAAATTTATTTATACCAAATGTAGGTACAGGTTGAACTGTTTATCCTCCTTTATCATCATATTTATTTCATTCATCACCTTCTGTTGATATTGCAATTTTTTCTCTTCATATAACAGGAATTTCTTCTATTATTGGATCATTAAATTTTATTGTGACAATTATAATAATAAAAAATTATTCATTAAATTATGATCAAATTAATTTATTTTCATGATCTGTATGTATTACAGTAATTTTATTAATTTTATCTTTACCAGTTTTAGCAGGTGCTATTACTATATTATTATTTGATCGAAATTTTAATACATCTTTTTTTGATCCAATAGGAGGAGGTGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGTTTAATTTCTCAAATTATTATAAATGAAAGAGGTAAAAAAGAAACTTTTGGAAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGATTTATTGTTTGGGCTCATCATATATTTACTGTAGGTTTAGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bombus subterraneus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 42
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bombus subterraneus

The short-haired bumblebee or short-haired humble-bee, Bombus subterraneus, is a species of bumblebee found in Eurasia, as well as in New Zealand, where it is an introduced species.[2]

B. subterraneus was one of four species of bumblebee introduced into New Zealand from the United Kingdom between 1885 and 1906 for pollination of red clover. In New Zealand, it is the rarest of the four species, with small numbers at a few locations in inland South Island.[3] The last recorded sighting of B. subterraneus in the United Kingdom was in 1988 and it is believed extinct there.[4] A programme was started in 2009 to reintroduce it to the United Kingdom with queen bees from New Zealand. The programme was run by Natural England, the Bumblebee Conservation Trust, the Royal Society for the Protection of Birds and bee and wasp charity Hymettus.[5][6] However, this was not a success, as many of the queens died during hibernation. DNA analysis of the New Zealand bees showed they lacked genetic diversity. In 2012, a second attempt was made to reintroduce the short-haired bumblebee using queens from Skåne province of southern Sweden.[7][8][9]

References[edit]

  1. ^ "Bombus subterraneus". Integrated Taxonomic Information System. 
  2. ^ Williams, Paul H.; An Jiandong; Huang Jiaxing (2011). "The bumblebees of the subgenus Subterraneobombus: integrating evidence from morphology and DNA barcodes". Zoological Journal of the Linnean Society 163: 813. doi:10.1111/j1096-3642.2011.00729.x. 
  3. ^ MacFarlane, R.P.; Gurr, L. 1995. Distribution of bumble bees in New Zealand. New Zealand Entomologist 18: 29-36.
  4. ^ Stewart, Lucy C.; Hale, Roddy, J. and Hale, Marie L. (2009). "Species-specific primers for the molecular identification of cryptic Bombus species in New Zealand". Conservation Genetics 11 (3): 1207. doi:10.1007/s10592-009-9920-2. 
  5. ^ Gibson, Eloise (2 June 2009). "British make beeline for South Island". New Zealand Herald. p. A5. Retrieved 2009-06-02. 
  6. ^ O'Connell, Sanjida (7 September 2009). "'Extinct' British subject repatriated after 100 years". New Scientist.
  7. ^ Kasprzak, Emma (5 May, 2012) How UK's humble bee project led to Swedish outrage BBC News England, Accessed 28 May 2012
  8. ^ Morelle, Rebecca (28 May 2012) 'Extinct' short-haired bumblebee returns to UK BBC News, Science and the Environment, Accessed 28 May 2012
  9. ^ Kennedy, Maev (27 May 2012) Bumblebee lost to UK makes comeback on Dungeness shingle The Guardian, Accessed 28 May 2012


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!