Overview

Brief Summary

Biology

The exceptionally long tongue of this species allows it to obtain nectar from plants with deep-tubed flowers, which honeybees and other bumblebees cannot exploit (5). It is an important pollinator of fruit trees and clover, and also visits deadnettle, foxgloves, cowslips and a range of other plants (4). Colonies contain between 50 and 120 insects, and are present between late April and early October (2). The queen is the only member of a colony to survive the winter, they emerge in April and begin to search for a suitable place in which to establish a nest (7). Nests are typically made underground, in banks and among tree roots (2), or occasionally above ground in bird boxes (7). The queen creates a circular chamber in which she builds a wax egg cell, and she lays her first batch of eggs inside. The eggs are laid on a layer of pollen, which is collected by the queen, and then covered with a layer of wax (5). After hatching, the white larvae are fed on honey and pollen by the queen. When they are fully-grown, the larvae cease to feed and develop into pupae after spinning a protective silk cocoon around themselves. During the pupal stage, the larvae undergo complex changes, and develop into adult workers. Throughout their development, the queen incubates this first brood by lying over the cell in which they grow, keeping them warm with the heat of her body. After emerging, the workers undertake the duties of foraging and nest care, and the queen remains inside the nest, producing further batches of eggs. When the colony reaches its peak, males and new queens are produced. Males develop from unfertilised eggs; after leaving the nest they fly around in search of new queens with which to mate. In this species, males are present between June and October, but their numbers peak towards the end of July (2). After mating, these new queens search for a place to hibernate. The colony and the old queen gradually die, and the newly mated queens emerge the following spring, to establish new colonies (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This is a large bumblebee, which has a fairly 'scruffy' appearance with long hair (3). It is a yellow, black and white banded species (2), with a long head. The tongue, which is as long as the body, is the longest of all bumblebees found in central Europe (4). Three 'castes' occur within bumblebee nests, a 'queen' (the reproductive female), 'workers' (non-reproductive females) and males (5). All three castes are broadly similar in appearance, but males can be distinguished as they lack stings and have longer antennae than females (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

This species is one of the commonest and most widespread of bumblebees in Britain (1). It is found throughout the Palaearctic region, and has been introduced to New Zealand and Iceland (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Found in a range of habitats, including the edges of woodlands and scrubby areas, and is common in gardens (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Plant / pollenated
adult of Bombus hortorum pollenates or fertilises flower of Spiranthes romanzoffiana
Other: major host/prey

Animal / parasitoid / endoparasitoid
solitary larva of Physocephala rufipes is endoparasitoid of adult of Bombus hortorum

Animal / sequestrates
female of Psithyrus barbutellus takes over nest of Bombus hortorum
Other: sole host/prey

Animal / parasitoid / endoparasitoid
solitary larva of Sicus ferrugineus is endoparasitoid of adult of Bombus hortorum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus hortorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAAATTATTTAATTCCTTTAATAATTGGATCTCCAGATATAGCATTTCCACGAATAAATAATATTAGATTTTGAATTTTACCACCTTCATTATTTTTATTATTATTAAGAAATTTATTTTCACCAAATGTTGGAACTGGATGAACTGTATATCCTCCACTATCTTCCTATTTATTTCATTCATCCCCATCTGTAGATATTGCTATTTTTTCATTACACATAACAGGAATTTCTTCTATTATTGGATCTTTAAATTTTATTGTAACTATTATATTTATAAAAAATTACTCATTAAATTATGATCAAATTAATCTATTTTCATGATCAGTATGTATTACAGTTATTTTATTACTTTTATCTCTTCCAGTTTTAGCAGGAGCTATTACAATATTACTTTTTGATCGAAATTTTAATACATCTTTTTTTGATCCAATAGGTGGTGGAGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCTGAAGTTTACATTTTAATTCTCCCAGGATTTGGATTAATTTCTCAAATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGAAACTTAGGAATAATTTATGCAATATTGGGAATTGGATTTTTAGGTTTTATTGTTTGAGCTCATCATATATTTACCGTTGGATTAGACGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bombus hortorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Abundant throughout Britain (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Many British bumblebee species have undergone a worrying decline, largely as a result of changes in agricultural practices leading to a loss of open habitats and important food plants (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Specific conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombus hortorum

Bombus hortorum is a species of bumblebee. It bears the common name Garden bumblebee, and can be found in most of Europe up to 70ºN, as well as parts of Asia and New Zealand.[2]

Contents

Description

This bumblebee has an oblong head and a very long glossa (tongue), up to 15 millimetres (0.59 in), in some cases even 20 millimetres (0.79 in). In fact the tongue is so long that the bee often fly with it extended when collecting nectar.[3] The queen is of a very variable size, body length between 19 millimetres (0.75 in) and 22 millimetres (0.87 in), wing span 35 millimetres (1.4 in) to 38 millimetres (1.5 in). The workers are almost as big, the larger ones overlapping the smaller queens. The colour is black with a yellow collar, a narrow yellow band on the scutellum, and a third yellow band on terga (abdominal segments) 1 and 2. The tail is white. Darker forms, with little yellow in their fur, are common.[4]

Ecology

The nest, normally containing 50 to 120 workers, can be built both over and below ground. Due to its long tongue this bumblebee mainly visits flowers with deep corollae, as deadnettles, ground ivy, vetches, clovers, comfrey, foxglove and thistles.[4]

As most bumblebee males the males of this bumblebee patrol a fixed circuit marking objects along the route, about a metre above ground, with a pheromone to attract daughter queens. This behaviour was noted already by Darwin 1886 in his own garden.[5]

Distribution

This species is found in Europe up to 70ºN (in Scandinavia, south of the tundra). In the west its distribution reaches Iceland, where it probably has been introduced. In the south it extends to the middle of the Iberian Peninsula, to southern Italy (Calabria), northern Turkey and to the Mediterranean islands except Corsica, Sicily and (probably) Sardinia. It continues in northern and central Asia through Siberia to the Altai Mountains, and, in the south-east, to northern Iran.[2] In 1885 it was introduced in New Zealand, where it still exists, however without being particularly common.[6]

In Britain it is widespread through the entire region, including Orkney and Shetland.[4]

References

  1. ^ ITIS Report
  2. ^ a b Pierre Rasmont. "Bombus (Megabombus) hortorum (Linnaeus, 1761)". Université de Mons. http://zoologie.umh.ac.be/hymenoptera/pagetaxon.asp?tx_id=3035. Retrieved 31 December 2012.
  3. ^ "Bombus hortorum the Garden bumblebee". Bumblebee.org. http://www.bumblebee.org/hort.htm. Retrieved 31 December 2012.
  4. ^ a b c Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 351–355. ISBN 0007174519.
  5. ^ Goulson, Dave Bumblebees: behaviour, ecology, and conservation p. 47
  6. ^ Goulson, Dave Bumblebees: behaviour, ecology, and conservation pp. 219-220
  • Goulson, Dave (2010). Bumblebees: behaviour, ecology, and conservation. Oxford, UK: Oxford University Press. ISBN 9780199553075.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!