Overview

Brief Summary

The buff-tailed bumble bee, also known as the humble-bee or large earth humble-bee (Bombus terrestris) is named for the queen's coloration - she has a buff-colored abdomen. This bee is native to Europe, coastal north Africa, and west and central Asia. The buff-tailed bumble bee pollinates fruit trees, raspberries, and blueberries, as well as greenhouse-grown tomatoes.

Buff-tailed bumble bees are black with a dull yellow band in front of the wings and across the middle of the body. The queens have a yellow thorax and buff colored abdomen. Males have a distinctive yellow nose.

  • Bombus terrestris and lucorum, Laura Brodie, University of Aberdeen, http://www.bumblebee.org/
  • Importation of Non-Native Bumble Bees into North America: Potential Consequences of Using Bombus terrestris and Other Non-Native Bumble Bees for Greenhouse Crop Pollination in Canada, Mexico, and the United States, K. Winter, L. Adams, R. Thorp, D. Inouye, L. Day, J. Ascher, and S.Buchmann, North American Pollinator Protection Campaign, August 2006
  • Subgenus Bombus Latreille, 1802 (Apidae: Apinae: Bombini), Thorp, R. W., and M. D. Shepherd. 2005. Profile: Subgenus Bombus In: Shepherd, M. D., D. M. Vaughan, and S. H. Black (Eds). Red List of Pollinator Insects of North America. CD-ROM Version 1 (May 2005).Portland, OR: The Xerces Society for Invertebrate Conservation
  • A century of advances in bumble bee domestication and the economic and environmental aspects of its commercialization for pollination, H. H. W. Velthuis, and A. van Doorn, Apidologie, vol. 37, no. 4, 2006, pp. 421-451.
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

This species is native to Europe, coastal north Africa, and west and central Asia.

  • Bombus terrestris and lucorum (Laura Brodie, University of Aberdeen, www.bumblebee.org)
  • Importation of Non-Native Bumble Bees into North America: Potential Consequences of Using Bombus terrestris and Other Non-Native Bumble Bees for Greenhouse Crop Pollination in Canada, Mexico, and the United States (K. Winter, L. Adams, R. Thorp, D. Inouye, L. Day, J. Ascher, and S. Buchmann, North American Pollinator Protection Campaign, August 2006)
  • Buff-tailed bumble bee - Bombus terrestris - Family: Apidae (Natural England)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The buff-tailed bumble bee nests in abandoned rodent nests found in shady spots.

  • Bombus terrestris and lucorum (Laura Brodie, University of Aberdeen, www.bumblebee.org)
  • Importation of Non-Native Bumble Bees into North America: Potential Consequences of Using Bombus terrestris and Other Non-Native Bumble Bees for Greenhouse Crop Pollination in Canada, Mexico, and the United States (K. Winter, L. Adams, R. Thorp, D. Inouye, L. Day, J. Ascher, and S. Buchmann, North American Pollinator Protection Campaign, August 2006)
  • Buff-tailed bumble bee - Bombus terrestris - Family: Apidae (Natural England)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Foodplant / robber
Bombus terrestris robs flower of Orobanche rapum-genistae

Plant / pollenated
queen of Bombus terrestris pollenates or fertilises flower of Dactylorhiza purpurella

Animal / parasitoid / endoparasitoid
solitary larva of Physocephala rufipes is endoparasitoid of adult of Bombus terrestris

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus vestalis takes over nest of Bombus terrestris
Other: sole host/prey

Animal / parasitoid / endoparasitoid
solitary larva of Sicus ferrugineus is endoparasitoid of adult of Bombus terrestris

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Fertilized queens emerge from hibernation in early spring and start a new colony in abandoned rodent nests. About three weeks later workers emerge and take over gathering food - nectar and pollen - and cell building. The queen then concentrates her efforts on egg laying. As many as 250 workers are found in a nest. Males appear in summer, and males and females fly out of the nest to mate. Males are not allowed back into the nest and die soon after mating. The newly fertilized queens begin searching for a place to hibernate, but the workers and old queen die during winter.

  • Bombus terrestris and lucorum (Laura Brodie, University of Aberdeen, www.bumblebee.org)
  • Importation of Non-Native Bumble Bees into North America: Potential Consequences of Using Bombus terrestris and Other Non-Native Bumble Bees for Greenhouse Crop Pollination in Canada, Mexico, and the United States (K. Winter, L. Adams, R. Thorp, D. Inouye, L. Day, J. Ascher, and S. Buchmann, North American Pollinator Protection Campaign, August 2006)
  • Buff-tailed bumble bee - Bombus terrestris - Family: Apidae (Natural England)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus terrestris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 71 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAAATTATCTAATTCCATTAATATTAGGATCCCCAGATATAGCTTTTCCTCGAATAAATAATATTAGATTTTGACTTCTACCTCCATCATTATTCATATTATTATTAAGAAATATATTTACACCTAATGTAGGTACAGGATGAACTGTATATCCTCCTTTATCTTCTTATTTATTTCATTCATCACCTTCAATTGATATTGCAATTTTTTCTTTACATATATCAGGAATCTCTTCAATTATTGGATCATTAAATTTTATCGTTACTATTTTATTAATAAAAAATTTTTCATTAAATTATGATCAAATTAATTTATTTTCATGATCAGTATGTATTACAGTAATTTTATTAATTCTATCTTTACCAGTATTAGCCGGTGCAATTACTATATTATTATTTGATCGAAATTTTAATACTTCATTTTTTGACCCAATAGGAGGAGGAGACCCAATCCTTTATCAACATTTATTTTGATTTTTTGGCCACCCAGAAGTATATATTTTAATTTTACCAGGATTTGGATTAATCTCTCAAATTATTATAAATGAAAGAGGTAAAAAAGAAACCTTTGGAAATTTAAGAATAATTTATGCTATATTAGGAATTGGATTTTTAGGTTTTATTGTTTGAGCTCATCATATATTTACTGTAGGATTAGACGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bombus terrestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 66
Specimens with Barcodes: 107
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

This species is widespread and common throughout its range.

  • Bombus terrestris and lucorum (Laura Brodie, University of Aberdeen, www.bumblebee.org)
  • Importation of Non-Native Bumble Bees into North America: Potential Consequences of Using Bombus terrestris and Other Non-Native Bumble Bees for Greenhouse Crop Pollination in Canada, Mexico, and the United States (K. Winter, L. Adams, R. Thorp, D. Inouye, L. Day, J. Ascher, and S. Buchmann, North American Pollinator Protection Campaign, August 2006)
  • Buff-tailed bumble bee - Bombus terrestris - Family: Apidae (Natural England)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Pollinator

The buff-tailed bumble bee is an efficient commercial pollinator for several reasons: it is widely distributed; it produces large colonies; and it is adaptable to artificial conditions and diverse climatic conditions, habitats, and flower types. Although these bees are efficient pollinators, they also are known to be nectar robbers - when they find a flower with nectar too deep for them to reach they bite a hole near the base of the corolla and drink the nectar through the hole. When the bees collect nectar this way, they do not necessarily pollinate the flower.

Since the late 1980's, this species has been used for commercial pollination of greenhouse-grown tomato crops throughout Europe and in countries where the species is not native, such as New Zealand and Japan. In 1995 and 1996 shipments of the buff-tailed bumble bee were allowed into Mexico. Shortly after this importation, the internal bumble bee parasite Nosema bombi (a microsporidian or very small species of fungi) was discovered in shipments of the buff-tailed bumble bee and all imported colonies were destroyed and importation permits retracted.

Many countries have concerns about importing these non-native bees. In addition to outbreaks of disease, other concerns include: threatening the relationships between native plants and pollinators; introducing new diseases; and disrupting genetic adaptations by hybridizing with native species. Because of these concerns, restrictions on importation of the buff-tailed bumble bee exist in the Canary Islands, Norway, Japan, China, South Africa, New South Wales, and Australia. The importation of the buff-tailed bumble bee is prohibited in the United States, Canada, and Mexico. However, even with these restrictions, close to one million buff-tailed and eastern bumble bee (B. impatiens) colonies are reared commercially each year in 16 countries in Europe, Asia, South America, and Australia each year (Velthuis, H. H. et al., 2006).

  • Bombus terrestris and lucorum, Laura Brodie, University of Aberdeen, http://www.bumblebee.org/
  • Importation of Non-Native Bumble Bees into North America: Potential Consequences of Using Bombus terrestris and Other Non-Native Bumble Bees for Greenhouse Crop Pollination in Canada, Mexico, and the United States, K. Winter, L. Adams, R. Thorp, D. Inouye, L. Day, J. Ascher, and S.Buchmann, North American Pollinator Protection Campaign, August 2006
  • Subgenus Bombus Latreille, 1802 (Apidae: Apinae: Bombini), Thorp, R. W., and M. D. Shepherd. 2005. Profile: Subgenus Bombus In: Shepherd, M. D., D. M. Vaughan, and S. H. Black (Eds). Red List of Pollinator Insects of North America. CD-ROM Version 1 (May 2005).Portland, OR: The Xerces Society for Invertebrate Conservation
  • A century of advances in bumble bee domestication and the economic and environmental aspects of its commercialization for pollination, H. H. W. Velthuis, and A. van Doorn, Apidologie, vol. 37, no. 4, 2006, pp. 421-451.
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombus terrestris

Bombus terrestris, the buff-tailed bumblebee or large earth bumblebee is one of the most numerous bumblebee species in Europe. The queen is 2–2.7 cm long, while the workers are 1½–2 cm. The latter are characterized by their white-ended abdomens and look (apart from their yellowish bands being darker in direct comparison) just like those of the white-tailed bumblebee, B. lucorum, a close relative. The queens of B. terrestris have the namesake buff-white abdomen ("tail") tip; this area is white like in the workers in B. lucorum.

Such bees can navigate their way back to the nest from a distance as far away as 13 kilometres (8.1 mi), although most forage within 5 km from their nest.[1]

Contents

Life cycle

The first bumblebees to be seen in spring are the queens – the queen is the only bumblebee to hibernate through the winter. The queen is much bigger than the workers, which appear later. As soon as the queen has found some nectar, to replenish her energy reserves, she starts looking for a suitable site to build her nest.

The nest site is usually underground; an abandoned mouse burrow is often used. Inside, the queen first builds a nectar pot, which will sustain her during bad weather. She also begins to build up a pollen larder, which will feed her brood.

The queen then lays a small batch of eggs. Once these hatch she tends the larvae, feeding them with nectar and pollen. When the larvae are grown they pupate, and about 2 weeks later the first worker bumblebees emerge. These workers will forage for nectar and pollen for the colony, and tend later generations of larvae. The queen can now concentrate on egg laying and does not need to leave the nest again. The workers are smaller than the queen, and will only live for a few weeks. The foraging range and frequency of workers depends on the quality and distribution of available forage but most workers forage within a few hundred metres of their nest.[2]

Towards the end of summer the queen lays some unfertilized eggs which develop into male bees. Some eggs are also laid which receive extra food and pupate to become new queens. When the males emerge from the nest they do not return, foraging only for themselves. They seek out the new queens and mate with them.

B. terrestris is thought to be a mainly singly mating species. This is unusual for social insect queens where mating with several males (polyandry) has been shown to have several benefits. The lack of multiple mating by B. terrestris queens may be caused by male interference in the process. B. terrestris males plug the female's sexual tract with a sticky secretion during mating which appears to temporarily reduce the female's ability to successfully mate with other males for several days.[3]

When the autumn cold weather sets in, all but the young queens will die. The latter seek out a safe place to hibernate, they are the only ones to survive the winter.

Domestication

Since 1987 B. terrestris has been bred commercially for use as a pollinator for European greenhouse crops, particularly tomatoes — a task which was previously carried out by human hand.[4][5] B. terrestris has been commercially reared in New Zealand since the early 1990s[6][7] and is now used in at least North Africa, Japan, Korea and Russia, with the global trade in bumblebee colonies probably exceeding 1 million nests per year.[8]

Environmental concerns

In 2008 the Australian Government banned the live import of B. terrestris into Australia on the grounds that it would present a significant risk of becoming a feral species and thereby present a threat to native fauna and flora.[9] In 2004, this bumblebee was classified as a Key Threatening Process by the Scientific Committee of the New South Wales Department of Environment.[10] It is also classified as an "invasive alien species" in Japan.[5]

This species was introduced to Chile in 1998. It has crossed into Argentina, and is spreading at about 275 km per year. Where it occurs, the only bumblebee native to southern South America, Bombus dahlbomii, disappears within weeks. The previously introduced (1982) Bombus ruderatus is also seriously affected. The cause is thought to be the parasite Apicystis bombi, an organism carried by the Buff-tails, but which has no adverse affect on that species.[11]

References

  1. ^ Louisa Cheung (July 26, 2006). "Homing instinct of bees surprises". BBC News. 
  2. ^ Stephan Wolf & Robin F. A. Moritz (2008). "Foraging distance in Bombus terrestris L. (Hymenoptera: Apidae)". Apidologie (EDP Sciences) 39 (4): 419–427. doi:10.1051/apido:2008020. 
  3. ^ Annette Sauter, Mark J. F. Brown, Boris Baer & Paul Schmid-Hempel (2001). "Males of social insects can prevent queens from multiple mating". Proceedings of the Royal Society B 268 (1475): 1449–1454. doi:10.1098/rspb.2001.1680. PMC 1088762. PMID 11454287. 
  4. ^ Anon. "Natural pollination". Koppert Biological Systems. Koppert B.V. Retrieved 18 September 2011. 
  5. ^ a b Matsumura, Chizuru; Jun Yokoyama and Izumi Wasitani (August 2004). "Invasion Status and Potential Ecological Impacts of an Invasive Alien Bumblebee, Bombus terrestris L. (Hymenoptera: Apidae) Naturalized in Southern Hokkaido, Japan". Global Environmental Research (AIRIES): 51–66. 
  6. ^ Velthuis, H. H. W. and van Doorn, A. (April 2004) 'The breeding, commercialization and economic value of bumblebees.' in B. M. Freitas and J. O. P. Pereira (eds) Solitary Bees Conservation, Rearing and Management for Pollination. Federal University of Ceara, Brasil, pp. 135-149
  7. ^ http://biobees.co.nz/biology.html
  8. ^ Dave Goulson (2010). "Bumblebees. Behaviour, Ecology and Conservation" Oxford University Press.
  9. ^ "Bumblebee rejected for live import". Australian Government. 26 October 2008. Retrieved 1 January 2009. 
  10. ^ Paul Adam (February 2004). "Introduction of the large earth bumblebee, Bombus terrestris - key threatening process listing". NSW Government. Retrieved 1 January 2009. 
  11. ^ Goulson, Dave (2013). "Argentinian invasion!". Buzzword 21: 17–18. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!