Overview

Distribution

Geographic Range

Native to North America (Marshall 2000).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult two-spotted lady beetles are 4-5mm long, and ovoid in shape. The head and thorax is black with yellow markings. Their undersides are black to reddish-brown; Their elytra (wing covers) are orange with one black spot on each side. The larvae are elongate, with soft bodies, and are black with yellow and white spots (they look a little like tiny alligators) (Marshall 2000, Milne & Milne 2000).

Range mass: 0 to 0 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Lady beetles will live in nearly any vegetation, as long as there are aphids or other small insects to eat.

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Lady beetles feed on aphids and other small insects, insect eggs, and mites.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Adalia bipunctata in Illinois

Adalia bipunctata Linnaeus: Coccinellidae, Coleoptera
(this observation is from Graenicher)

Salicaceae: Salix discolor [unsp sn] (Gr)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Adalia bipunctata is prey of:
Linyphia triangularis
Agelena labyrinthica

Based on studies in:
England, Oxshott Heath (Heath, Plant substrate)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Adalia bipunctata preys on:
Dilachnus pini
Acyrthosiphon spartii
Aphis sarathamni
Arytaina spartii
Arytaina genistae

Based on studies in:
England, Oxshott Heath (Heath, Plant substrate)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / predator
adult of Adalia bipunctata is predator of Aphidoidea

Animal / predator
Adalia bipunctata is predator of egg of Phaedon cochleariae

Animal / parasitoid / endoparasitoid
larva of Phalacrotophora berolinensis is endoparasitoid of pupa (newly formed) of Adalia bipunctata

Animal / parasitoid / endoparasitoid
larva of Phalacrotophora fasciata is endoparasitoid of pupa (newly formed) of Adalia bipunctata

Animal / parasite / ectoparasite
several hundred nymph of Podapolipus ectoparasitises inside of elytra of adult of Adalia bipunctata
Other: major host/prey

Animal / parasitoid / endoparasitoid
gregarious (ave. 10) larva of Tetrastichus coccinellae is endoparasitoid of larva of Adalia bipunctata

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Females deposit bright yellow eggs on the underside of leaves and other locations near potential food sources for the larvae. Pupae are black with yellow dots and are found hanging from leaf surfaces. Adults in the North live through the winter; there can be more than one generation in a year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Adalia bipunctata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBCL0921-06|AJ313070|Adalia bipunctata| AATAAATGGTTATTTTCTACTAACCATAAAGATATTGGAACATTATATTTTTTATTTGGTTTATGAGCAGGAATAGTAGGAACTTCTCTA---AGAATTATTATTCGATTAGAATTAGGTACAACTAACAGACTAATTGGAAAT---GACCAAATTTATAATGTTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGTTTTGGAAACTGACTAGTACCTTTAATA---ATTGGAGCGCCTGATATGGCATTCCCACGTCTTAATAATATAAGATTTTGATTATTACCTCCAGCTTTAACCCTTTTAATTTCTAGAAGAGTAATTGAAATGGGAGCAGGTACAGGATGAACAGTATATCCACCTCTTTCTTCAAATATAGCACATAATGGGCCTTCTGTAGATTTA---GTAATTTTTAGATTACACTTAGCTGGAATTTCATCAATTTTAGGAGCTGTAAATTTTATTTCTACTATTATAAATATACGACCTAATGGGATAAATCTAGATAAAACACCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTCTACTACTTTTATCATTACCAGTTCTTGCAGGA---GCAATTACTATATTATTAACAGATCGTAATATTAATACATCATTTTTTGACCCTACTGGAGGAGGGGATCCAGTTTTATACCAACACTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTACACAAGAAAGAGGGAAAAAA---ATTGCTTTTGGAGCCTTAGGTATAATTTATGCTATATTAGCTATTGGTTTACTAGGATTTGTTGTATGAGCACATCATATATTTACTGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adalia bipunctata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 24
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Non-native lady beetle species have been introduced into North America for additional aphid control, and there is some concern that these species are displacing native species like the Two-Spot. (Marshall 2000)

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Can be a nuisance if large numbers get inside houses (Klaas 1998, Fleming 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This species helps control populations of aphids that are agricultural and horticultural pests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Adalia bipunctata

Adalia bipunctata, commonly known as the two-spot ladybird, two-spotted ladybug or two-spotted lady beetle, is a carnivorous[1] beetle of the family Coccinellidae that is found throughout the holarctic region. It is very common in western and central Europe and North America. It is used as a biological control agent.

Contents

Taxonomy

The two-spotted ladybird was one of the many species originally described by Linnaeus in his 18th century work, Systema Naturae, its original name was Coccinella bipunctata.[2] Its specific name from the Latin bi- "two", and punctata "spotted".[3]

Phenotypic variations

The most familiar form of the two-spot ladybird beetle is the red one with the two black spots. However, there also exists a black form with red spots on it. In addition, there are intermediate forms, but they occur only rarely in nature.[4]

Prey

Two-spotted lady beetles feed on aphids and other small insects.[1][4][5]

Life cycle

Life cycle

The two-spotted lady beetle's life cycle starts with eggs that are usually laid in clutches.[1][5] The larvae hatches from the egg by biting a hole in it. The larvae look very different from the adults: they have elongated, grey, soft bodies with six legs but no wings. They are cannibalistic. Larvae go through four larval stages: by eating they grow and at some point they shed their old skin and appear in a new one in which they can grow more. The last larval stage is approximately the size of an adult beetle. Once it has eaten enough, the larvae attach themselves to a substrate and moult into a pupa. Inside the pupa, the adult develops. Finally the adult ecloses from the pupa.

Sex ratio anomalies

Spotted lady beetles mating

Symbiosis

In some populations, the majority of the beetles are female. In these populations, 80-90% of the offspring of a female are female. The cause of this anomaly is the presence of symbiotic bacteria living within the gametic cells of the female lady beetles. The bacterium is too large to live in the male gametes (sperm), so the bacterium can be transmitted to the next generation only through female gametes. When it ends up in a male, it will die when the male dies. Therefore, it kills most of the male embryos in the newly laid eggs. These dead embryos then serve as food for their sisters when they emerge from their eggs. This trait is associated with a variety of different bacteria (Wolbachia,[6] Rickettsia,[7] Spiroplasma[8]), which are present in between 0 and 20% of females, depending on locality.[citation needed]

Parasitism

The two spot ladybird also carries a sexually transmitted infection in Central and Eastern Europe. The infection is an ectoparasitic mite Coccipolipus hippodamiae that transfers between male and female (and female and male) during copulation.[9] The infection sterilizes female two spot ladybirds, and at some points of the year, up to 90% of adult 2-spots become infected.[10][citation needed]

As biological control agent

A. bipunctata is used as a localised biological control agent against aphids in, for example, greenhouses.[citation needed]. The Two-spotted lady beetle was introduced into Australia specifically as a biological control agent.[11]

References

  1. ^ a b c "Two-spotted Lady Beetle Adalia bipunctata". www.enature.com. http://www.enature.com/fieldguides/detail.asp?recnum=IS0016. Retrieved 2009-02-14. 
  2. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata.. Holmiae. (Laurentii Salvii).. 
  3. ^ Simpson, D.P. (1979). Cassell's Latin Dictionary (5 ed.). London: Cassell Ltd.. ISBN 0-304-52257-0. 
  4. ^ a b "Adalia bipunctata (Linnaeus, 1758:364)". www.discoverlife.org. http://www.discoverlife.org/20/q?search=Adalia+bipunctata. Retrieved 2009-02-14. 
  5. ^ a b "Adalia bipunctata two-spotted lady beetle". animaldiversity.ummz.umich.edu University of Michigan. http://animaldiversity.ummz.umich.edu/site/accounts/information/Adalia_bipunctata.html. Retrieved 2009-02-14. 
  6. ^ Hurst, G., Jiggins, F. M., Graf von Der Schulenburg, J. H., Bertrand, D. et al (1999). Male killing Wolbachia in two species of insects. Proc R Soc B, 266: 735–740.
  7. ^ Werren, J. H., Hurst, G. D. D., Zhang, W., Breeuwer, J. A. J. et al (1994). Rickettsial relative associated with male killing in the ladybird beetle (Adalia bipunctata). J Bacteriol, 176: 388–394.
  8. ^ Insect Mol Biol. 1999 Feb;8(1):133-9. Invasion of one insect species, Adalia bipunctata, by two different male-killing bacteria. Hurst GD, Graf von der Schulenburg JH, Majerus TM, Bertrand D, Zakharov IA, Baungaard J, Völkl W, Stouthamer R, Majerus ME.
  9. ^ Hurst GDD, Sharpe RG, Broomfield AH, Walker LE, Majerus TMO, Zakharov IA, Majerus MEN (1995) Sexually transmitted disease in a promiscuous insect, Adalia bipunctata. Ecological Entomology 20: 230-236
  10. ^ Webberley K M, Buszko J, Isham V and Hurst G D D (2006) Sexually transmitted disease epidemics in a natural insect population. Journal Of Animal Ecology vol 75 issue 1 pp 33-43 ://000235043700004
  11. ^ "Adalia bipunctata (Linnaeus)". www.ento.csiro.au CSIRO. 7 July 2005. http://www.ento.csiro.au/aicn/system/c_724.htm. Retrieved 2009-02-14. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!