Overview

Brief Summary

Biology

Both adults and larvae are voracious predators of aphids, and are one of the gardener's greatest natural allies (4). Ladybirds lay their yellow eggs in small groups on leaves (5). The black larvae have relatively long legs, and they are active predators. When threatened, adults exude a bright yellow distasteful substance from the joints of the legs, which dissuades potential predators from eating a ladybird. Adults overwinter in garden sheds, amongst vegetation, in crevices in fences and a range of similar locations, and can often be discovered in fairly large numbers during this time. They emerge in March and April (4). There is much folklore centred on ladybirds; ladybird numbers are said to indicate the number of aphids due that particular year, they are also widely thought to bring good luck, particularly with regards to romance (4). There are many rhymes associated with these beetles, the most well known in England begins: 'Ladybird, ladybird, fly away, your house is on fire and your children are gone' (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Ladybirds are perhaps the most well-known and popular of all British beetles, and the seven-spot ladybird is one of the commonest species (2). This rounded beetle has bright red wing cases with 7 black spots, although some individuals may have more or fewer spots. The thorax is black with patches of pale yellow at the front corners (3). The common name of this group of beetles, 'ladybird', was originally given to the seven-spot in honour of the Virgin Mary; the red wing cases symbolising the Virgin's red cloak, with the seven spots representing her seven joys and seven sorrows. The larvae are blackish in colour and are active predators of aphids (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

5.5-7.8 mm long. A red or orange-red ladybug with seven black spots (Acorn, 2007; Belicek, 1976). Although it commonly has seven spots the number of spots can range from 0-9 (Majerus & Kearns, 1989). This makes it easily confused with nine-spotted ladybug, but nine-spotted ladybugs have a pale orange colour and a dark line where the wing covers meet (Acorn, 2007). In Europe, it can be confused with scarce seven-spot ladybug (Coccinella magnifica). Coccinella septempunctata have one small white triangular mark on the underside of the thorax under the middle pair of legs on each side. Whereas, C. magnifica have two small triangular marks on the underside of thorax, one under each the middle and hind pair of legs on each side (Majerus & Kearns, 1989).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Coccinella septempunctata originated in Europe and Asia, but is now found throughout the Middle East, India and North America (U.S. and Canada). Several intentional introductions of C. septempunctata occurred between 1951 to 1971 in the U.S. for biological control of crop threatening aphids. None of these releases were thought to be successful in creating a natural population until 1973 when an established population was found in Hackensack Meadowland, New Jersey. However, this population was thought to have arisen from an accidental release. Populations continued to arise in the eastern U.S. and Canada, either purposefully or unintentionally in the following years. Since then, this species has become one of the most common and widespread coccinellid species in the Nearctic range.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Native )

  • Gordon, R. 1985. The Coccinellidae (Coleoptera) of America north of Mexico. New York Entomological Society, 93: 1-912.
  • Honek, A., Z. Martinkova. 2005. Long term changes of Coccinella septempunctata (Coleoptera: Coccinellidae) in the Czech Republic. European Journal of Entomology, 102: 443-448.
  • Maredia, K., S. Gage, D. Landis, T. Wirth. 1992. Ecological observations on predatory Coccinellidae (Coleoptera) in southwestern Michigan. The Great Lakes Entomologist, 25: 265-270.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Before it was introduced to North America between 1951 and 1970, its range extended throughout Europe and Asia. Now it is commonly found throughout most of North America (Acorn, 2007; ADW, 2012).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found in central and northern Europe and is extremely common and widespread in Britain (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Coccinella septempunctata looks like the quintessential ladybug: it is medium sized, has orangish-red elytra and black spots. It can be identified however, by several distinct characteristics. This species typically has seven black spots on its elytra (although it can range from 0 to 9). There is one spot next to the scutellum that bridges the junction between the two elytra; there are two white patches on either side of the scutellum, just above this black scutellar spot. The three spots on each elytra are variable in placement, but are generally rather bold. This species also has two characteristic pale white spots along the anterior side of the pronotum. The ventral side of the abdomen is convex and is almost exclusively black; males have slight hairs on the last abdominal segment.

The eggs of Coccinella septempunctata are small (1mm long) and oval-shaped.

The larval instars of C. septempunctata can be variable in color depending on temperature but are generally dark and highly segmented. Size increases with each consecutive molting.

The pupa is slate grey to black, sometimes having white or orange markings on the outside. It has a hardened exoskeleton which develops from the fourth instar. Its size is approximately the size of the adult Coccinella septempunctata.

Range length: 6.50 to 7.8 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; poisonous

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Coccinella septempunctata can be found wherever significant numbers of prey, particularly aphids, are present. This normally includes small herbaceous plants, shrubs and trees in open fields, grasslands, marshes, agricultural fields, suburban gardens and parks. The preferred overwintering habitat for Coccinella septempunctata is an open area with sheltering boulders, small tussocks, or hedgerows of densely packaged grasses that are south-facing, maximizing sunlight hours.

Range elevation: sea level to 1500 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; scrub forest ; mountains

Wetlands: marsh

Other Habitat Features: suburban ; agricultural

  • Cantrell, C. 2011. "Seven-spotted Lady Beetle (Coleoptera: Coccinellidae)" (On-line). Accessed August 07, 2012 at http://ninnescahlife.wichita.edu/node/378.
  • Hodek, I., J. Michaud. 2008. Why is Coccinella septempunctata so successful? (a point-of-view). European Journal of Entomology, 105: 1-12.
  • Hoebeke, R., A. Wheeler. 1983. Exotic insects reported new to northeastern United States and eastern Canada since 1970. New York Entomological Society, 91: 193-222.
  • Honek, A., Z. Martinkova, S. Pekar. 2007. Aggregation characteristics of three species of Coccinellidae (Coleoptera) at hibernation sites. European Journal of Entomology, 104: 51-56.
  • Turnock, W., I. Wise, F. Matheson. 2003. Abundance of some native coccinellines (Coleoptera: Coccinellidae) before and after the appearance of Coccinella septempunctata. The Canadian Entomologist, 135: 391-404.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diverse. It is a habitat generalist and is found throughout most habitats (Acorn, 2007; Kearns & Majerus, 1989) where significant prey, especially aphids is available (Majerus, 1989).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This ladybird occurs in a wide range of habitats and is a familiar garden denizen (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Coccinella septempunctata is a polyphagous species; it mainly preys on aphids and other similar scale insects, but when such resources are low, adults will eat pollen. Some adults will even eat conspecific eggs or larvae if the situation calls for it. Larvae are predators of aphids generally, but will eat other Coccinellidae larvae if aphids are absent. Intraguild predation and cannibalism are major pressures in this species and family.

Animal Foods: insects

Plant Foods: pollen

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It is polyphagus, primarily feeding on aphids. Various different aphids are essential for development. Adults dislike artificial food (Hodek, 1973). If food is low adults and larvae will eat their relatives and pollen (ADW, 2012).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Coccinella septempunctata are voracious predators of plant harming aphids and scale insects. The ability of this species to depress the populations of these insects is valuable in an ecosystem and helps control the destruction of plants that are important for other organisms. C. septempunctata is prey to many bird, small mammal, and spider species, as well as other Coccinellidae.

Coccinella septempunctata serves as host to a large variety of parasites and parasitoids. Parasitic wasps  of the families Eulophidae and Braconidae, and flies of the family Phoridae parasitize the larvae of C. septempunctata. The braconid wasps Perilitus coccinellae and Dinocampus coccinellae are the most well known species that are parasitoids of Coccinella septempunctata. P. coccinellae develops in sync with the larvae and/or adult of the ladybird beetle and will even remain at the diapause induced state until the host comes out of diapause. D. coccinellae eggs are typically deposited within the body cavity of a female of Coccinella septempunctata and proceed to hatch and eat the eggs of the female. The host is unaffected by the further progress of this wasp larva until it pupates within a leg of the host and emerges as an adult up to 9 days later; some adults are apparently able to revive from this emergence event and continue their life cycle.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coccinella septempunctata and other coccinellids have very few natural enemies in their adult stages. The typical bright colors of coccinellids, with high contrasting orange and black spots, functions as aposematic warning coloration. The visual cue of toxicity seen in coccinellids is successful in deterring most predators, but chemical signals are also a major defense component. Coccinella septempunctata has several toxic N-oxides and alkaloids that exude from the gland between the femora and tibia. These chemicals can be released due to threats or attacks from predators and can account for up to 20% of the body weight of the beetle. These compounds are highly toxic to many common beetle predators like birds and small mammals. Spiders are also known to prey on Coccinella septempunctata larvae. Intraguild predation and cannibalism on eggs and larvae are also significant threats. The fourth larval instar is the most vulnerable instar to predation, with a significant number of individuals perishing during this stage, though the explanation for this trend has yet to be explained in a controlled study.

Known Predators:

Anti-predator Adaptations: aposematic

  • Abassi, S., M. Birkett, J. Petersson, J. Pickett, L. Wadhams, C. Woodcock. 2001. Response of the ladybird parasite Dinocampus coccinellae to toxic alkaloids from the seven-spot ladybird, Coccinella septempunctata. Journal of Chemical Ecology, 21: 33-43.
  • Kindlmann, P., H. Yasuda, S. Sato, S. Katsuhro. 2000. Key life stages of two predatory ladybird species (Coleoptera: Coccinlellidae). European Journal of Entomology, 97: 495-499.
  • Miura, K. 2009. Parasitizing the ladybird beetle, Coccinella septempunctata L. (Coleoptera: Coccinellidae) from Japan. Entomological News, 121: 95-96.
  • Riddick, E., T. Cottrell, K. Kidd. 2009. Natural enemies of the Coccinellidae: parasites, pathogens and parasitoids. Biological Control, 51: 306-312.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / predator
adult of Coccinella septempunctata is predator of Aphidoidea

Animal / predator
Coccinella septempunctata is predator of egg of Phaedon cochleariae

Animal / parasitoid / endoparasitoid
gregarious larva of Homalotylus eytelweini is endoparasitoid of larva of Coccinella septempunctata

Animal / parasitoid / endoparasitoid
larva of Perilitus coccinellae is endoparasitoid of adult of Coccinella septempunctata

Animal / parasitoid / endoparasitoid
larva of Phalacrotophora fasciata is endoparasitoid of pupa (newly formed) of Coccinella septempunctata

Animal / parasitoid / endoparasitoid
gregarious (up to 25) larva of Tetrastichus coccinellae is endoparasitoid of larva of Coccinella septempunctata

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Coccinella septempunctata is prey of:
Linyphia triangularis
Agelena labyrinthica

Based on studies in:
England, Oxshott Heath (Heath, Plant substrate)

This list may not be complete but is based on published studies.
  • O. W. Richards, 1926. Studies on the ecology of English heaths III. Animal communities of the felling and burn successions at Oxshott Heath, Surrey. J. Ecol. 14:244-281, from pp. 263-64.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Coccinella septempunctata preys on:
Dilachnus pini
Acyrthosiphon spartii
Aphis sarathamni
Arytaina spartii
Arytaina genistae
Insecta

Based on studies in:
England, Oxshott Heath (Heath, Plant substrate)

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • O. W. Richards, 1926. Studies on the ecology of English heaths III. Animal communities of the felling and burn successions at Oxshott Heath, Surrey. J. Ecol. 14:244-281, from pp. 263-64.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The chemical cues used by Coccinella septempunctata are fairly well documented. There are several compounds that are used throughout its life and for a variety of behaviors. This species overwinters in aggregations within dense foliage, and implements chemical cues to attract other individuals. This specific pheromone for Coccinella septempunctata was isolated and identified to be 2-isopropyl-3-methoxy-pyrazine. This cue not only attracts individuals to a relatively safe overwintering aggregation, but also ensures that the group will exit diapause with a local population to mate with. Several chemical cues are also used in finding prey, particularly aphids. For instance, the alarm pheromone that aphids release from their cornicles when a predator is sensed (used as a warning between aphids) is an attractant to C. septempunctata. Cues released by plants in response to aphid herbivory are also utilized by coccinellids to locate aphid infested plants.

Intraguild predation during the larval stage is high in this family of predaceous insects as an adaptation due to the short-lived nature of aphid colonies and the limited distances that larvae can travel to locate food. Due to this high evolutionary pressure, Coccinella septempunctata is deterred by the compounds associated with hetero- and conspecific eggs, which decreases the likelihood of offspring mortality due to cannibalism and predation.

Communication Channels: visual ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; chemical

  • Peterson, J., V. Ninkovic, R. Glinwood, M. Birkett, J. Pickett. 2005. Foraging in a complex environment- semiochemicals support searching behavior of the seven spot ladybird. European Journal of Entomology, 105: 365-370.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

According to studies done in Europe, adults emerge in late March or early April. The adults were observed mating a week or two after their emergence. The second generation adults emerged in June. While the young (second generation) females rarely mate until they have over-wintered, young males will mate with older (first generation) females. This creates a partial second generation (Majerus, 1994). In Alberta, it is common for this specie to produce three generations in one year (Acorn, 2007).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

After emergence from the egg, a larva will remain with its egg casing, eat it, and eat any infertile eggs in the vicinity. As the instars develop, they shift from sucking aphid liquids as meals to eating the entire insect. Coccinella septempunctata has four instars, the lengths of which are largely influenced by the abundance of aphids and temperature. Before pupation, the fourth instar will stop foraging for 24 hours and attach itself to a substrate with the tip of its abdomen. After emergence from the pupal casing, Coccinella septempunctata has very soft elytra that lack pigmentation. The characteristic coloration develops with time. The red and black pigments of the elytra are derived from melanins, while the lighter areas develop from carotenes.

Development - Life Cycle: metamorphosis ; diapause

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In a healthy larva, the first instar takes 22.4%, the second takes 18.4%, the third takes 17.2% and the fourth takes 41.9% of the total development time (Hodek & Honek, 1996). The larva will stop feeding 24 hours before pupating. When the pupa first emerges its elytra is soft and lacks pigment (ADW, 2012). The colouration happens over time and depends on the environment e.g. light orange under 35°C and 55% relative humidity, but dark brown under 15°C and 95% relative humidity. An increase in temperature above 200C for larval rearing has a negative effect on the weight of adult beetles e.g. increasing the temperature form 20°C to 25°C decreases the weight from 39 mg to 35.5 mg (Hodek & Honek, 1996). Sexually mature males will copulate by mouthing a female. Immature and females that are ready to lay eggs will resist this behavior. Individuals may mate multiple times to increase fecundity. Females eject spermatophore, for reason unknown. A female can lay anywhere from 200 to 1000 eggs. When eggs are being ova posited, females will avoid areas with the eggs of same species and will only deposit around 15 eggs at a spot. Breeding starts during spring/early summer and continues into fall (ADW, 2012).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

An adult Coccinella septempunctata lifespan is generally between 1 to 2 years, depending on its survival through the winter.

Typical lifespan

Status: wild:
1 to 2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Coccinella septempunctata reproduces sexually, with each male and female copulating with multiple partners in a breeding season. Males court females with a five step display: approach, watch, examine, mount and copulatory attempt. During the approach stage, a male will come within 1 cm of a desired female and watch her without making contact. The male will then examine the female by feeling her antennae and mouth with his own (examine). If suitable and accepting, the male will mount the female by climbing onto the elytra from behind and attempt copulation.

A sexually immature female will resist courtship from a male, along with females that have recently mated or are about to lay eggs. In one day, an individual might mate 4 to 6 times. Each female will mate with many males over the course of her lifespan. The multiple matings of females greatly increases fecundity, viability of eggs, and percent of successful hatchings. Females of Coccinella septempunctata are known to eject spermatophores, but do not eat them. There are no data suggesting the reason for spermatophore ejection in this species.

Unmated males and virgin females show the longest and most vigorous copulation, both of which decrease as an individual continues to accrue mating partners. Less vigorous mating is also prominent in males that copulate multiple times during one day, apparently due to exhaustion from exertion during previous copulations.

Mating System: polygynandrous (promiscuous)

Once a female has fertilized eggs she will begin to disperse them around her environment. A female might lay anywhere from 250 to 500 eggs in her lifespan. Coccinella septempunctata females are deterred by some olfactory cues of conspecific eggs in an area, and will lay eggs in areas without other eggs of the same species. Each suitable substrate will receive a maximum of 15 eggs. It is hypothesized that this trait allows females to have higher egg dispersal rates and also decreases intraspecific competition of larvae. There is a tendency in this species to produce more eggs than the carrying capacity of the environment, which places many offspring at high risk of mortality; however, occasional high abundances of aphids might make this reproductive strategy beneficial. Some males will fertilize females shortly before diapause, which causes some females to overwinter with sperm stored in their spermathecae.

Breeding interval: Coccinella septempunctata will breed from the point of sexual maturation (10 to 14 day after emergence) until dormancy.

Breeding season: The main breeding season of this species is spring and early summer, though a portion of the population continues into autumn.

Range eggs per season: 200 to 1000.

Average eggs per season: 440.

Range age at sexual or reproductive maturity (female): 10.8 to 11.6 days.

Average age at sexual or reproductive maturity (female): 11.4 days.

Range age at sexual or reproductive maturity (male): 8.5 to 9.3 days.

Average age at sexual or reproductive maturity (male): 8.8 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous ; sperm-storing ; delayed fertilization

Like all coccinellids, Coccinella septempunctata lacks any parental care. Males merely copulate with a female, while females do not influence development of offspring beyond providing nutrients in the eggs and depositing eggs on safe and resource rich substrates.

Parental Investment: pre-hatching/birth (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coccinella septempunctata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTATCGCTTATTATCGGCCACTTTATCGAATAAATGATTATTTTCTTCTAATCATAAAGATATTGGAACATTATATTTCTTATTCGGAATATGAGCCGGAATAATTGGGACCTCTTTAAGAATTTTAATTCGTCTTGAATTAGGAACTACTAATAGATTAATTGGAAATGACCAAATTTATAATGTAATTGTAACAGCTCATGCCTTCATTATAATTTTTTTTATAGTTATACCGATTATAATTGGAGGATTTGGAAATTGACTTGTTCCTTTAATAATTGGAGCACCTGATATAGCTTTCCCTCGATTAAATAATATAAGATTTTGACTACTCCCACCTGCCTTAACCTTACTTATTATTAGAAGATTAGTGGAAATAGGTGCAGGAACTGGATGAACTGTCTATCCTCCTTTATCCTCTAACTTAGCTCATAATGGGCCTTCAGTAGATTTAGTAATTTTTAGTTTACACTTAGCAGGTATCTCATCTATTTTAGGAGCCGTAAATTTTATTTCAACTATTATAAATATACGACCATTTGGCATAAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coccinella septempunctata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 397
Specimens with Barcodes: 506
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Coccinella septempunctata is considered an invasive species and is not on any conservation lists, globally, nationally, or within any state.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

They are an invasive species that are not on any conservation list, nationally or internationally due to their relative abundance (ADW, 2012).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Very common in Britain (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This beetle is very common and is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Many native coccinellid species are being driven away by Coccinella septempunctata; unrealized human benefits from these native species could therefore be lost as Coccinella septempunctata continues to dominate more and more ecosystems. Emerging dominance of this species outside of agricultural landscapes could detriment overall ecosystem health. Any retrospective restoration efforts could be costly to humans. Coccinella septempunctata is also a nuisance to the wine industry, as it is sometimes accidentally caught on crops and incorporated during the wine making process. Chemicals produced by C. septempunctata taint the taste and quality of wine.

  • Botezatu, A., Y. Kotseridis, D. Inglis, G. Pickering. 2013. Occurrence and contribution of alkyl methoxypyrazines in wine tainted by Harmonia axyridis and Coccinella septempunctata. Journal of the Science of Food and Agriculture, 93/4: 803-810.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coccinella septempunctata is a common species used for biological control in agriculture settings, as its main prey is the aphid, a major agricultural pest. Aphids are small Hemipterans that eat the phloem from a diverse set of plants and can have devastating effects on crop yields. Aphids also harm plants by indirectly transferring diseases and fungi. C. septempunctata is one of the most successful aphidophagous insects and has been employed across the U.S. to control aphid populations. The ability of C. septempunctata to be so successful in a large range of habitats makes it especially beneficial to humans who need crop security from aphid infestations.

Positive Impacts: controls pest population

  • Tatchell, G. 1989. An estimate of the potential economic losses to some crops due to aphids in Britain. Crop Protection, 8: 25-29.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Coccinella septempunctata

Coccinella septempunctata, the seven-spot ladybird (or, in North America, seven-spotted ladybug or "C-7"[1]), is the most common ladybird in Europe. Its elytra are of a red colour, but punctuated with three black spots each, with one further spot being spread over the junction of the two, making a total of seven spots, from which the species derives both its common and scientific names (from the Latin septem = "seven" and punctus = "spot").

Biology[edit]

A larva of C. septempunctata

C. septempunctata has a broad ecological range, living almost anywhere there are aphids for it to eat. Both the adults and the larvae are voracious predators of aphids, and because of this, C. septempunctata has been repeatedly introduced to North America as a biological control agent to reduce aphid numbers, and is now established in North America, and has been subsequently designated the official state insect of five different states (Delaware, Massachusetts, New Hampshire, Ohio, and Tennessee).

In the United Kingdom, there are fears that the seven-spot ladybird is being outcompeted for food by the harlequin ladybird.[2] Conversely, in North America, this species has outcompeted many native species, including other Coccinella.

Anatomy and physiology[edit]

An adult seven-spot ladybird may reach a body length of 7.6–10.0 mm (0.3–0.4 in). Their distinctive spots and attractive colours apparently make them unappealing to predators. The species can secrete a fluid from joints in their legs which gives them a foul taste. A threatened ladybug may both play dead and secrete the unappetising substance to protect itself.[3] The seven-spot ladybird synthesizes the toxic alkaloids, N-oxide coccinelline and its free base precoccinelline; depending on sex and diet, the spot size and coloration can provide some indication of how toxic the individual bug is to potential predators.[4]

Gallery[edit]

References[edit]

  1. ^ "Coccinella septempunctata (Linnaeus,1758:365). Seven-spotted lady beetle; Seven-spotted ladybug". Discover Life. Retrieved November 29, 2010. 
  2. ^ Ben Quinn (November 7, 2006). "Home-grown ladybirds put to flight by alien invasion". The Daily Telegraph. 
  3. ^ "Ladybug Profile". National Geographic. National Geographic Society. Retrieved October 3, 2009. 
  4. ^ J. Blount, H. Rowland, F. Drijfhout, J. Endler, R. Inger, J. Sloggett, G. Hurst, D. Hodgson & M. Speed (2012). "How the ladybird got its spots: effects of resource limitation on the honesty of aposematic signals". Functional Ecology 26 (2): 1–9. doi:10.1111/j.1365-2435.2012.01961.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!