Overview

Brief Summary

Biology

Both adults and larvae are voracious predators of aphids, and are one of the gardener's greatest natural allies (4). Ladybirds lay their yellow eggs in small groups on leaves (5). The black larvae have relatively long legs, and they are active predators. When threatened, adults exude a bright yellow distasteful substance from the joints of the legs, which dissuades potential predators from eating a ladybird. Adults overwinter in garden sheds, amongst vegetation, in crevices in fences and a range of similar locations, and can often be discovered in fairly large numbers during this time. They emerge in March and April (4). There is much folklore centred on ladybirds; ladybird numbers are said to indicate the number of aphids due that particular year, they are also widely thought to bring good luck, particularly with regards to romance (4). There are many rhymes associated with these beetles, the most well known in England begins: 'Ladybird, ladybird, fly away, your house is on fire and your children are gone' (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Ladybirds are perhaps the most well-known and popular of all British beetles, and the seven-spot ladybird is one of the commonest species (2). This rounded beetle has bright red wing cases with 7 black spots, although some individuals may have more or fewer spots. The thorax is black with patches of pale yellow at the front corners (3). The common name of this group of beetles, 'ladybird', was originally given to the seven-spot in honour of the Virgin Mary; the red wing cases symbolising the Virgin's red cloak, with the seven spots representing her seven joys and seven sorrows. The larvae are blackish in colour and are active predators of aphids (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The seven-spotted ladybug is native to parts of western Europe, and has been introduced into much of North America (World Kids Network 1996, Marshall 2000).

Biogeographic Regions: nearctic (Introduced ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found in central and northern Europe and is extremely common and widespread in Britain (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The adult seven-spotted lady beetle is relatively large (7-8 mm). The body is oval and dome-shaped, and it has a white or pale spot on either side of the head. The black spot pattern on the body is usually 1-4-2, with either red or orange forewings.

Lady beetle larva can grow up to 7-8 mm in length and are dark with three pairs of prominent legs. Eggs are about 1 mm long and are small and spindle shaped (Weeden, et al 1996).

Range length: 7-8 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The seven-spotted ladybug lives in a wide variety of habitats. Any place where there are plants and aphids may attract this species (Fleming 2000).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This ladybird occurs in a wide range of habitats and is a familiar garden denizen (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The seven-spotted lady beetle is carnivorous. Both the adult and larval stages feed on insects harmful to plants, such as aphids and scale insects (Anonymous 1997). Adults can be known to eat up to 100 aphids a day (Arnett Jr., et al 1980). Rather than using any complicated methods for eating its prey, the ladybug kills its prey outright and then devours it (Waldbauer, 1998).

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / predator
adult of Coccinella septempunctata is predator of Aphidoidea

Animal / predator
Coccinella septempunctata is predator of egg of Phaedon cochleariae

Animal / parasitoid / endoparasitoid
gregarious larva of Homalotylus eytelweini is endoparasitoid of larva of Coccinella septempunctata

Animal / parasitoid / endoparasitoid
larva of Perilitus coccinellae is endoparasitoid of adult of Coccinella septempunctata

Animal / parasitoid / endoparasitoid
larva of Phalacrotophora fasciata is endoparasitoid of pupa (newly formed) of Coccinella septempunctata

Animal / parasitoid / endoparasitoid
gregarious (up to 25) larva of Tetrastichus coccinellae is endoparasitoid of larva of Coccinella septempunctata

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Coccinella septempunctata is prey of:
Linyphia triangularis
Agelena labyrinthica

Based on studies in:
England, Oxshott Heath (Heath, Plant substrate)

This list may not be complete but is based on published studies.
  • O. W. Richards, 1926. Studies on the ecology of English heaths III. Animal communities of the felling and burn successions at Oxshott Heath, Surrey. J. Ecol. 14:244-281, from pp. 263-64.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Coccinella septempunctata preys on:
Dilachnus pini
Acyrthosiphon spartii
Aphis sarathamni
Arytaina spartii
Arytaina genistae
Insecta

Based on studies in:
England, Oxshott Heath (Heath, Plant substrate)

This list may not be complete but is based on published studies.
  • O. W. Richards, 1926. Studies on the ecology of English heaths III. Animal communities of the felling and burn successions at Oxshott Heath, Surrey. J. Ecol. 14:244-281, from pp. 263-64.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

In the spring, overwintering adults first find food and then lay their eggs. Eggs are laid in clusters of 10 to 50 within aphid colonies. Eggs hatch in three to five days, and larvae feed on aphids or other insects for two to three weeks, then pupate. Adults emerge in seven to ten days (Lyon 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Coccinella septempunctata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 397
Specimens with Barcodes: 506
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Coccinella septempunctata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTATCGCTTATTATCGGCCACTTTATCGAATAAATGATTATTTTCTTCTAATCATAAAGATATTGGAACATTATATTTCTTATTCGGAATATGAGCCGGAATAATTGGGACCTCTTTAAGAATTTTAATTCGTCTTGAATTAGGAACTACTAATAGATTAATTGGAAATGACCAAATTTATAATGTAATTGTAACAGCTCATGCCTTCATTATAATTTTTTTTATAGTTATACCGATTATAATTGGAGGATTTGGAAATTGACTTGTTCCTTTAATAATTGGAGCACCTGATATAGCTTTCCCTCGATTAAATAATATAAGATTTTGACTACTCCCACCTGCCTTAACCTTACTTATTATTAGAAGATTAGTGGAAATAGGTGCAGGAACTGGATGAACTGTCTATCCTCCTTTATCCTCTAACTTAGCTCATAATGGGCCTTCAGTAGATTTAGTAATTTTTAGTTTACACTTAGCAGGTATCTCATCTATTTTAGGAGCCGTAAATTTTATTTCAACTATTATAAATATACGACCATTTGGCATAAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Very common in Britain (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This beetle is very common and is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species hibernates in groups, and sometimes enters houses in large numbers, looking for a place to spend the winter. They don't bite or damage household goods, but can be a nuisance (Bernard 1994, Fleming 2000, Klaas 1998).

Many different species of ladybugs, including the seven-spotted ladybug, have been brought to North America to be used in biological control of pests. The problem is that some of the imported ladybugs are competing with the local ladybugs for food and habitat, and have displaced the natives in many areas. This can reduce ladybug biodiversity and and my damage local ecosystems (CNF Ladybug Survey 2000, Marshall 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Lady bugs, who eat aphids and other harmful pests such as scale insects, take care of the pest problems in gardens, orchards and farms (CNF Ladybug Survey 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Coccinella septempunctata

Coccinella septempunctata, the seven-spot ladybird (or, in North America, seven-spotted ladybug or "C-7"[1]), is the most common ladybird in Europe. Its elytra are of a red colour, but punctuated with three black spots each, with one further spot being spread over the junction of the two, making a total of seven spots, from which the species derives both its common and scientific names (from the Latin septem = "seven" and punctus = "spot").

Biology[edit]

C. septempunctata has a broad ecological range, living almost anywhere there are aphids for it to eat. Both the adults and the larvae are voracious predators of aphids, and because of this, C. septempunctata has been repeatedly introduced to North America as a biological control agent to reduce aphid numbers, and is now established in North America, and has been subsequently designated the official state insect of five different states (Delaware, Massachusetts, New Hampshire, Ohio, and Tennessee).

In the United Kingdom, there are fears that the seven-spot ladybird is being outcompeted for food by the harlequin ladybird.[2] Conversely, in North America, this species has outcompeted many native species, including other Coccinella.

Anatomy and physiology[edit]

An adult seven-spot ladybird may reach a body length of 7.6–10.0 mm (0.3–0.4 in). Their distinctive spots and attractive colours apparently make them unappealing to predators. The species can secrete a fluid from joints in their legs which gives them a foul taste. A threatened ladybug may both play dead and secrete the unappetising substance to protect itself.[3] The seven-spot ladybird synthesizes the toxic alkaloids, N-oxide coccinelline and its free base precoccinelline; depending on sex and diet, the spot size and coloration can provide some indication of how toxic the individual bug is to potential predators. [4]

Gallery[edit]

References[edit]

  1. ^ "Coccinella septempunctata (Linnaeus,1758:365). Seven-spotted lady beetle; Seven-spotted ladybug". Discover Life. Retrieved November 29, 2010. 
  2. ^ Ben Quinn (November 7, 2006). "Home-grown ladybirds put to flight by alien invasion". The Daily Telegraph. 
  3. ^ "Ladybug Profile". National Geographic. National Geographic Society. Retrieved October 3, 2009. 
  4. ^ J. Blount, H. Rowland, F. Drijfhout, J. Endler, R. Inger, J. Sloggett, G. Hurst, D. Hodgson & M. Speed (2012). "How the ladybird got its spots: effects of resource limitation on the honesty of aposematic signals". Functional Ecology 26 (2): 1–9. doi:10.1111/j.1365-2435.2012.01961.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!