Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Coleomegilla maculata in Illinois

Coleomegilla maculata De Geer: Coccinellidae, Coleoptera
(observations are from Robertson and Graenicher)

Alismataceae: Sagittaria latifolia [stam fp icp] (Rb); Apiaceae: Pastinaca sativa sn (Rb), Sium suave fp (Rb), Zizia aurea sn (Rb); Asteraceae: Antennaria neglecta [unsp sn] (Gr), Anthemis cotula sn/fp (Gr), Aster macrophyllus sn/fp (Gr), Cirsium arvense sn/fp (Gr), Krigia biflora fp np (Rb), Solidago canadensis fp (Rb); Lauraceae: Sassafras albidum sn (Rb); Polemoniaceae: Polemonium reptans sn (Rb); Portulacaceae: Claytonia virginica fp np (Rb); Ranunculaceae: Enemion biternatum fp np (Rb), Ranunculus abortivus fp (Rb), Ranunculus septentrionalis fp np (Rb); Salicaceae: Salix interior [stam sn fq icp] (Rb); Santalaceae: Comandra umbellata sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coleomegilla maculata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAATATGAGCAGGAATAATTGGTACTTCTCTCAGTATTTTAATTCGATTAGAATTAGCTTCAACAGGAAGATTAATCGGAAACGACCAAATTTATAATGTAATTGTAACAGCCCATGCTTTTGTTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGGAACTGACTTGTCCCTTTAATAATTGGGGCCCCTGATATAGCTTTCCCACGTTTAAATAATATAAGATTTTGGTTATTACCACCTTCTTTAACTCTTCTTTTATCTAGAATACTAGTTGAAATAGGAGCAGGAACTGGATGAACAGTTTATCCCCCCTTATCCTCTAATCTAGCTCATAATGGATCTTCTGTAGATTTAGTAATTTTTAGATTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCAGTTAATTTTATTTCTACTATTTTAAATATACGTCCCATAGGAATAGAATTAGATAAAACTCCCCTATTTGTCTGATCAGTATTAATTACAGCTATTCTCCTTTTATTATCATTACCTGTATTAGCTGGAGCTATTACAATATTATTAACTGACCGAAATTTAAATACCTCATTTTTTGACCCTATGGGAGGAGGTGACCCTATTTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coleomegilla maculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 57
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spotted lady beetle

Coleomegilla maculata, commonly known as the spotted lady beetle, pink spotted lady beetle or twelve-spotted lady beetle, is a large coccinellid beetle native to North America. The adults and larvae feed primarily on aphids and the species has been used as a biological control agent.

Description[edit]

The spotted lady beetle is about six millimetres long, more flattened than most species of lady beetle, pink or red with six spots on each wing cover. The thorax is a similar shade of red with two large triangular black patches. The larvae resemble miniature alligators and are dark coloured. They have three pairs of legs and grow to about six millimetres long. The eggs are spindle shaped and laid upright in groups near potential prey.[1]

Life cycle[edit]

A female beetle may lay up to 1,000,000 eggs[citation needed] in small groups in protected sites on stems and leaves over a three-month period. The larvae actively seek out prey and may travel as far as twelve metres in their search for food. The larvae grow rapidly, moulting four times [1] before attaching themselves by the abdomen to a leaf or other surface to pupate. The adult beetles emerge from three to twelve days later depending on the temperature. There are two to five generations per year. This species is most abundant in September when they congregate before mating and winter hibernation. They overwinter in large aggregations in leaf litter, under stones and in other protected sites at the edge of fields and hedgerows. They emerge in spring and look for suitable prey and egg laying sites in nearby crops, often dispersing by walking along the ground.[2]

Habitat[edit]

These lady beetles can be seen wherever the insects on which they prey are found. Crops which support aphid populations include wheat, sorghum, sweet corn, alfalfa, soybeans, peas, beans, cotton, potatoes, brassicacious crops, tomatoes, asparagus and apples.[2] Besides aphids, they include in their diet adelgids,[1] mites, insect eggs and small larvae. They also eat pollen which may constitute up to 50% of their food intake,[2] nectar, water and honeydew. When normal prey is scarce, both adults and larvae sometimes exhibit cannibalistic tendencies, eating eggs, larvae and pupae of their own species.[1]

Research[edit]

It has been found experimentally that interplanting a crop susceptible to aphid attack with a flowering plant such as the dandelion, Taraxacum officinale, encouraged predation on aphids because the spotted lady beetles were attracted to their pollen-rich flowers.[3]

The spotted lady beetle commonly oviposits on the native weed, Acalypha ostryaefolia, when it grows near sweet corn crops in Kentucky. A research study showed that the insect favoured the weed over the corn even though it housed no prey insects. The first instar larvae fell from the weed plants and crawled across the soil for a distance of up to eight metres a day before ascending a sweet corn plant or another weed plant. The presence of this weed, in close proximity to the crop, resulted in more beetle larvae on the crop than was the case when the weed was absent.[4]

Research showed that spotted lady beetle larvae were an important cause of natural mortality for Helicoverpa zea eggs on sweet corn.[5]

A study identified the spotted lady beetle as a significant predator of the eggs of the European corn borer, Pyrausta nubilalis, with consumption averaging sixty eggs per day.[6]

Another study has shown that the spotted lady beetle reduced populations of eggs and small larvae of the Colorado potato beetle, Leptinotarsa decemlineata, on potatoes and that the rate of consumption was highly correlated with the air temperature.[7]

Biological control[edit]

Manipulative biological control aims to make use of the lady beetles already present in the environment by making conditions as favorable as possible for them and by avoiding spraying chemicals that will interfere with their predation.[1]

Augmentative biological control recognises that lady beetles may be present but may be insufficient in numbers to control the pest species and seeks to make up this deficit.[1]

Classical biological control seeks to introduce a species that is not already present in the environment in the hope that it will become established and eventually control the pest.[1] Supplies of the spotted lady beetle are available commercially for this purpose.

References[edit]

  1. ^ a b c d e f g J. Howard Frank and Russell F. Mizell, III (August 2009). "Ladybirds". University of Florida Institute of Entomology and Nematology, publication # EENY-170, Featured Creatures. Retrieved 2010-12-23. 
  2. ^ a b c Cornell University
  3. ^ Coleomegilla maculata (Coleoptera: Coccinellidae) predation on pea aphids promoted by proximity to dandelions
  4. ^ Factors influencing dispersal of larval Coleomegilla maculata from the weed Acalypha ostryaefolia to sweet corn
  5. ^ Importance of predation by Coleomegilla maculata larvae in the natural control of the corn earworm in sweet corn
  6. ^ The Spotted Lady Beetle, Coleomegilla maculata (De Geer), as a Predator of European Corn Borer Eggs
  7. ^ Coleomegilla maculata (Coleoptera: Coccinellidae): Its Predation upon the Colorado Potato Beetle (Coleoptera: Chrysomelidae) and Its Incidence in Potatoes and Surrounding Crops
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!