Overview

Brief Summary

Harmonia axyridis, the Asian ladybird beetle, is a recognizable coccinellid beetle with red/orange or black wing elytra sporting 0 to 22 spots. Three color forms are especially common: red or orange with black spots (known as form succinea); black with four red spots (form spectabilis); and black with two red spots (form conspicua), although many other variants are also described. As well as feeding on many aphid and scale species, Harmonia axyridis eats a large variety of beetle and Lepidoptera species, and will also eat flower nectar and pollen. The Asian ladybird beetle is native to eastern Asia, but has been introduced to North America and Europe to control aphids and scale insects. It is now common, well known and spreading in those regions. The wide geographical spread of this insect is cause for concern in some places, as it is a threat to native species and biodiversity, can damage crops (especially grapes) and migrates into houses in the fall, becoming a household pest. Harmonia axyridis beetles often aggregate in large numbers, and use pheromones to communicate and attract more beetles. These aggregation pheromones have been analyzed and synthesized to develop traps for control and monitoring of the ladybird.

(Koch, 2003; Wikipedia 2011)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Harmonia axyridis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATACCTTTTATTTGGAATATGGGCAGGAATAGTAGGAACATCGTTAAGTATTTTAATTCGGTTAGAATTAGGAACTAGAGGAAGATTAATTGGAAAC---GACCAAATTTATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGAAATTGGTTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCATTTCCACGATTAAATAACATAAGATTTTGACTTTTACCCCCTGCTTTAACTCTTTTAATTTTAAGAACAATCGTAGAAATAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTTTGACCCAACCGGTGGGGGAGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Harmonia axyridis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 98
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Harmonia axyridis

Harmonia axyridis is a large coccinellid beetle. Its colour ranges from yellow-orange to black, and the number of spots between 0 and 22. It is native to eastern Asia, but has been introduced to North America and Europe to control aphids and scale insects. It is now common, well known and spreading in those regions, and has also established in South Africa and widely across South America.

It is commonly known as the Harlequin ladybird (because it occurs in numerous colour forms). It is also known in North America as the multicolored Asian lady beetle, and (because it invades homes in October in preparation for overwintering) as Halloween lady beetle.[1][2] In Japan it is not generally distinguished from the seven-spot ladybird which is also common there.

When the species first arrived in the UK, it was labelled in jest as "the many-named ladybird", because among the names listed were: multivariate, southern, Japanese, and pumpkin ladybird.[3]

Contents

Description

Harmonia axyridis is a "typical" coccinellid beetle in shape and structure, being domed and having a "smooth" transition between its elytra (wing coverings), pronotum and head. It occurs in three main color forms: red or orange with black spots (known as form succinea); black with four red spots (form spectabilis); and black with two red spots (form conspicua). However, numerous other forms have also been recorded, particularly in the native range. The beetle is typically large for a coccinellid (5.5–8.5 mm long) and even more dome-shaped than native European species. These characteristics distinguish H. axyridis from native species in the UK.

A useful informal clue for distinguishing this species from most other Coccinellidae is that the pronotum of the succinea colour forms of Harmonia axyridis has white markings that typically define an "M"-shaped black area, as seen on a beetle resting head-upwards (or "W"-shaped if it is head-down). They always have reddish-brown legs and are obviously brown on the underside of the abdomen, even in the melanic colour forms.[2]

Range

Harmonia axyridis New Year cartoon

H. axyridis is native to eastern Asia from central Siberia, Kazakhstan and Uzbekistan in the west, through Russia south to the Himalayas and east to the Pacific coast and Japan, including Korea, Mongolia, China and Taiwan. As a voracious predator, it was identified as a biocontrol agent for aphids and scale insects. Consequently, it has been introduced into greenhouses, crop fields and gardens in many countries, including the United States and parts of Europe. The species is now established in the United States, Canada, Argentina, Brazil, the United Kingdom, Denmark, the Netherlands, Belgium, Luxembourg, France, Germany, Czech Republic, Hungary, Poland and South Africa.[2]

North America

typical Harmonia axyridis specimen from northern California

This species became established in North America as the result of introductions into the United States in an attempt to control the spread of aphids. In the last three decades, this insect has spread throughout the United States and Canada and has been a prominent factor in controlling aphid populations.

In the U.S., the first introductions took place as far back as 1916. The species repeatedly failed to establish in the wild after successfully controlling aphid populations, but an established population of beetles was observed in the wild near New Orleans, Louisiana around 1988. In the following years it quickly spread to other states, being occasionally observed in the Midwest within 5–7 years and becoming common in the region by about 2000. The species was also established in the northwest by 1991, and the northeast by 1994, aided by additional introductions from the native range, rather than just reaching there from the southeast. It is reported that it has heavily fed on soybean aphids (which recently appeared in the U.S. after coming from China), supposedly saving farmers vast sums of money in 2001.

Worldwide propagation

Worldwide routes of propagation of H. axyridis have been described with genetic markers in 2010.[4] The populations in eastern and western North America originated from two independent introductions from the native range.[4] The South American and African populations both originated independently from eastern North America.[4] The European population also originated from eastern North America, but with substantial genetic admixture with individuals of the European biocontrol strain (estimated at about 40%).[4]

Many people now view this species as a nuisance,[5] partly due to their tendency to overwinter indoors and the unpleasant odor and stain left by their bodily fluid when frightened or squashed, as well as their tendency to bite humans.[5] In Europe it is currently increasing to the detriment of indigenous species,[5] its voracious appetite enabling it to out-compete and even eat other ladybirds.[5] Native ladybird species have experienced often dramatic declines in abundance in areas invaded by H. axyridis.[6]

In addition to its household pest status[citation needed], it has been reported to be a minor agricultural pest contaminating crops of tender fruits and grapes[7] in Iowa, Ohio, New York State, and Ontario.[8] The contamination of grapes by this beetle has been found to alter the taste of wine.[9]

Biology and behavior

Life cycle: mating, eggs, five larval stages, pupa and newly-emerged adult

H. axyridis become dormant in cooler months, though they will wake up and move around whenever the temperature reaches about 10 °C (50 °F). Because the beetles will use crevices and other cool, dry, confined spaces to overwinter, significant numbers may congregate inside walls if given a large enough opening.

These beetles make some use of pheromones to "call" each other, allowing for the large gatherings that are often seen in the autumn. This is exploited by the makers of H. axyridis traps. However, many cues are visual, both at long (eg, picking out light-coloured structures that are distinct from their surroundings) and short (eg picking out pre-existing aggregations to join) ranges, while non-volatile long-chain hydrocarbons laid down by previous aggregations also play a significant role in site selection. Both are more important than volatile pheromones.

They often congregate in sunlit areas because of the heat available, so even on fairly cold winter days, some of the hibernating beetles will "wake up" because of solar heating. These large populations can be problematic because they can form swarms and linger in an area for a long time. These beetles can form groups that tend to stay in upper corners of windows. This beetle has been also found to be attracted to dark screening material for its warmth. This beetle has good eyesight, and will come back from where it was removed, and is known to produce a small bite if provoked.[10]

H. axyridis, like other lady beetles or ladybirds, uses isopropyl methoxy pyrazine as a defensive chemical to deter predation, but also contains this chemical in its hemolymph at much higher concentrations than many other such species, along with species/genus-specific defensive compounds such as Harmonine. These insects will "reflex bleed" when agitated, releasing hemolymph from their legs. The liquid has a foul odour (similar to that of dead leaves) and can cause stains. Some people have allergic reactions, including allergic rhinoconjunctivitis when exposed to these beetles.[1] Sometimes, the beetles will bite humans,[1] presumably in an attempt to acquire salt, although many people feel a pricking sensation as a lady beetle walks across the skin which is just the pressure from the ladybird's feet. Bites normally do no more harm than cause irritation although a small number of people are allergic to bites.[11]

Different patterns

These beetles can be difficult to identify because of the variations in color, spot size, and spot count of the elytra. The easiest way to identify H. axyridis f. succinea is to look at the pronotum and see if the black markings look like a letter "W" or "M" (depending on if the marking is viewed from the front or the back). There is usually more white on the pronotum in this species than in most native North American species, though this is not useful if you are not currently in North America.

Control

Numerous methods of control have been investigated in areas where this beetle has been introduced and causes a threat to native species and biodiversity and to the grape industry. Methods of control include insecticides, trapping, removal of aggregates of beetles and mechanically preventing entry to buildings.[12] Methods under development involve the investigation of natural parasites and pathogens, including the use of parasitic sexually transmitted mites and fungal diseases.[13]

H. axyridis traps are available that contain the pheromones used by the beetles to attract each other into large gatherings. The best methods for dealing with them in private homes involve sealing openings they may enter.[14] Sweeping and vacuuming are considered effective methods for removing them from homes though this should be done carefully so as not to trigger the defensive reaction known as reflex bleeding. A nylon stocking placed inside the vacuum cleaner's hose, secured with a rubber band, allows the beetles to be "bagged" rather than collecting inside the machine.[15] A trap designed for indoor use was developed which attracts the beetles with a light and seals them in a removable bag, though as the beetles are not strongly attracted to light this does not work particularly well.[14]


References

  1. ^ a b c R. L. Koch (2003). "The multicolored Asian lady beetle, Harmonia axyridis: A review of its biology, uses in biological control, and non-target impacts" (PDF). Journal of Insect Science 3: 32. PMC 524671. PMID 15841248. 
  2. ^ a b c "The Harlequin Ladybird Survey". July 20, 2009. http://www.harlequin-survey.org/. Retrieved July 3, 2010.
  3. ^ Ladybird Survey page "Harmonia axyridis (Pallas) in Britain" [1] Accessed 7 Jan 2008
  4. ^ a b c d Eric Lombaert, Thomas Guillemaud, Jean-Marie Cornuet, Thibaut Malausa, Benoît Facon & Arnaud Estoup (2010). "Bridgehead Effect in the Worldwide Invasion of the Biocontrol Harlequin Ladybird". In Chave, Jerome. PLoS ONE 5 (3): e9743. doi:10.1371/journal.pone.0009743. PMC 2840033. PMID 20305822. 
  5. ^ a b c d http://www.harlequin-survey.org/factfile/concern.htm
  6. ^ Russell F. Mizell III (2007). "Impact of Harmonia axyridis (Coleoptera: Coccinellidea) on native arthropod predators on pecan and crape myrtle" (PDF). Florida Entomologist 90 (3): 524–536. doi:10.1653/0015-4040(2007)90[524:IOHACC]2.0.CO;2. ISSN 0015-4040. JSTOR 4494179. 
  7. ^ "Midwest Grape Production Guide Bulletin 919-05". http://ohioline.osu.edu/b919/0011.html. Retrieved 2011-01-31.
  8. ^ Betty Summerhayes (July 6, 2007). "OMAFRA Achievements in Crop Technology 2007". Government of Ontario. Archived from the original on January 16, 2011. http://web.archive.org/web/20090116041430/http://www.omafra.gov.on.ca/english/crops/resource/2007achieve.htm. Retrieved June 24, 2011.
  9. ^ Gary Pickering, James Lin, Roland Riesen, Andrew Reynolds, Ian Brindle & George Soleas. "Influence of Harmonia axyridis on the sensory properties of white and red wine". American Journal of Enology and Viticulture 55 (2): 153–159. 
  10. ^ "Multicolored Asian Ladybeetle (Harmonia axyridis)". http://www.pestid.msu.edu/InsectsArthropods/MulticoloredAsianLadybeetleHarmoniaaxyridis/tabid/253/Default.aspx.
  11. ^ "Medscape". Archived from the original on November 7, 2007. http://web.archive.org/web/20071107061907/http://www.medscape.com/viewarticle/547512?src=mp. Retrieved August 18, 2006.
  12. ^ Marc Kenis, Helen E. Roy, Renate Zindel & Michael E. N. Majerus (2008). Current and potential management strategies against H. axyridis. "From Biological Control to Invasion: the Ladybird Harmonia axyridis as a Model Species". BioControl 53 (1): 235–252. doi:10.1007/s10526-007-9136-7. 
  13. ^ Helen Elizabeth Roy, Peter M. J. Brown, Peter Rothery, Remy L. Ware & Michael E. N. Majerus (2008). Interactions between the fungal pathogen Beauveria bassiana and three species of coccinellid: Harmonia axyridis, Coccinella septempunctata and Adalia bipunctata. "From Biological Control to Invasion: the Ladybird Harmonia axyridis as a Model Species". BioControl 53 (1): 265–276. doi:10.1007/s10526-007-9122-0. 
  14. ^ a b "USDA site". Ars.usda.gov. http://www.ars.usda.gov/is/br/lbeetle/#prevention. Retrieved 2010-07-03.
  15. ^ "Ohio State University Extension Fact Sheet". Ohioline.osu.edu. http://ohioline.osu.edu/hse-fact/1030.html. Retrieved 2010-07-03.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!