Overview

Brief Summary

Harmonia axyridis, the Asian ladybird beetle, is a recognizable coccinellid beetle with red/orange or black wing elytra sporting 0 to 22 spots. Three color forms are especially common: red or orange with black spots (known as form succinea); black with four red spots (form spectabilis); and black with two red spots (form conspicua), although many other variants are also described. As well as feeding on many aphid and scale species, Harmonia axyridis eats a large variety of beetle and Lepidoptera species, and will also eat flower nectar and pollen. The Asian ladybird beetle is native to eastern Asia, but has been introduced to North America and Europe to control aphids and scale insects. It is now common, well known and spreading in those regions. The wide geographical spread of this insect is cause for concern in some places, as it is a threat to native species and biodiversity, can damage crops (especially grapes) and migrates into houses in the fall, becoming a household pest. Harmonia axyridis beetles often aggregate in large numbers, and use pheromones to communicate and attract more beetles. These aggregation pheromones have been analyzed and synthesized to develop traps for control and monitoring of the ladybird.

(Koch, 2003; Wikipedia 2011)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Harmonia axyridis, the Asian lady beetle, is native to the Oriental region, found in China, ranging to the far south (Yunnan and Guangxi Provinces), Japan, Korea, Mongolia, and parts of the Palearctic region, from northern Kazakhstan, and eastern Russia west to the Altai Mountains and north to Siberia. It has been introduced to at least four other continents. Its range covers the majority of North America; it is found in Mexico, across the United States (excluding Alaska and Wyoming) and much of southern Canada. This species has been found widely across South America, excluding Amazonian areas. Its habitat ranges across southern and western Europe into Bosnia and Herzegovina and Romania, and recently was found in Tunisia, Egypt, and South Africa.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Native ); ethiopian (Introduced ); neotropical (Introduced )

  • Brown, P., C. Thomas, E. Lombaert, D. Estoup, A. Jefferies, L. Lawson Handley. 2011. The global spread of Harmonia axyridis (Coleoptera: Coccinellidae): distribution, dispersal and routes of invasion. Biocontrol, 56(4): 623-641.
  • Osawa, N. 2000. Population field studies on the aphidophagous ladybird beetle Harmonia axyridis (Coleoptera: Coccinellidae): resource tracking and population characteristics. Population Ecology, 42(2): 115-127.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Harmonia axyridis is oval shaped and convex. It is a polymorphic species, with three main color morphs: red or orange with zero to many black spots (form succinea), or black with either four orange spots (form spectabilis) or two (form conspicua). Several less common morphs exist as well. Darker morphs are more common in its native range, with red or orange morphs more common in Europe and North America. The pronotum is generally white with four black spots that tend to form an "M" shape. This species has very distinct, square "shoulders." The last ventral segment on its abdomen differs between male and female individuals.

The eggs of H. axyridis are approximately 1.2 mm in length and yellow in color. Just before hatching, eggs darken to a gray or black coloration.

The larvae of H. axyridis have long bodies and are black with orange coloration (including two long orange lines on the dorsal-lateral areas of the abdomen, which start to develop after the first instar and are complete by the fourth and final instar). They have double-branched spines (scoli) running down the length of the body. The larval stages often grow longer than the final adult individual, starting at an approximate length of 1.9 to 2.1 mm in the first instar and growing to 7.5 to 10.7 mm in the fourth instar. Larvae vaguely resemble tiny black and orange alligators.

Pupae are exposed and generally shaped like an elongated dome, often attached to leaves. They tend to be orange, with the fourth instar exoskeleton still attached at the point of substrate attachment.

Range length: 5 to 8 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic ; poisonous

Sexual Dimorphism: sexes alike

  • Arnett, R. 1993. American insects: a handbook of the insects of America north of Mexico. Boca Raton, FL, USA: CRC Press.
  • Banks, C. 1957. The behaviour of individual coccinellid larvae on plants. The British Journal of Animal Behaviour, 5(1): 12-24.
  • Gordon, R. 1985. The Coccinellidae of America north of Mexico. Journal of the New York Entomological Society, 93: 1-912.
  • Sasaji, H. 1971. Coccinellidae. Tokyo: Academic Press of Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Harmonia axyridis can be found on many crop species in agricultural areas where it has been introduced. It is often found on deciduous trees, flowering plants, and other plant species found in open areas. This species tends to live in open fields, agricultural areas, and meadows.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Other Habitat Features: suburban ; agricultural

  • Borror, D., R. White. 1970. Peterson field guides: A field guide to the insects of America north of Mexico. Boston, MA, USA.: Houghton Mifflin.
  • Colunga-Garcia, M., S. Gage, D. Landis. 1997. Response of an assemblage of Coccinellidae (Coleoptera) to a diverse agricultural landscape. Entomological Society of America, 26(4): 797-804.
  • Hagan, K. 1962. Biology and ecology of predaceous Coccinellidae. Annual Review of Entomology, 7: 289-326.
  • Hodek, I. 1996. Ecology of Coccinellidae. New York, NY: Dordecht, Kluwever Academic.
  • Koch, R. 2003. The multicolored Asian lady beetle, Harmonia axyridis: a review of its biology, uses in biological control, and non-target impacts. Journal of Insect Science, 32(3): 1-16.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Harmonia axyridis is a predatory insectivore with chewing mandibles, primarily feeding on aphids and scale insects. They may also eat Thysanura species and mites. Butterfly and moth eggs may be eaten, as well. When other food sources are scarce, Harmonia axyridis has been known to eat other various Coccinellidae species. Occasionally, it may feed on grapes and similar fruits. Studies have seen that in some cases, this species will eat other sources, such as moths and pollen, but these are isolated incidences. Both adults and larvae of Harmonia axyridis will cannibalize eggs and smaller larvae.

Animal Foods: insects

Plant Foods: fruit; pollen

Primary Diet: carnivore (Insectivore )

  • Adriano, G., N. Vandenberg, J. McHugh, J. Forrester, S. Slipinski, K. Miller, L. Shapiro, M. Whiting. 2009. The evolution of food preferences in Coccinellidae. Biological Control, 51(2): 215-231.
  • Campbell, C., W. Cone. 1999. Consumption of damson-hop aphids (Phorodon humuli) by larvae of Coccinella transversoguttata and Hippodamia convergens (Coleoptera: Coccinellidae). Biocontrol Science and Technology, 9(1): 75-78.
  • Davidson, L., E. Evans. 2010. Frass analysis of diets of aphidophagous lady beetles (Coleoptera: Coccinellidae) in Utah alfalfa fields. Environmental Entomology, 39(2): 576-582.
  • Dixon, A. 2005. Insect predatory-prey dynamics: ladybird beetles and biological control. Cambridge, UK: Cambridge University Press.
  • Sloggett, J. 2008. Weighty matters: Body size, diet and specialization in aphidophagous ladybird beetles (Coleoptera: Coccinellidae). European Journal of Entomology, 105: 381-389.
  • Alhmedi, A., E. Haubruge, F. Francis. 2010. Intraguild interactions and aphid predators: biological efficiency of Harmonia axyridis and Episyrphus baltetus. Journal of Applied Entomology, 134(1): 34-44.
  • Berkvens, N., J. Bale, D. Berkvens, L. Tirry, P. De Clercq. 2010. Cold tolerance of the harlequin ladybird Harmonia axyridis in Europe. Journal of Insect Physiology, 56(4): 438-444.
  • Burgio, G., F. Santi, S. Maini. 2002. On intra-guild predation and cannibalism in Harmonia axyridis (Pallas) and Adalia bipunctata L. (Coleoptera: Coccinellidae). Biological Control, 24(2): 110-116.
  • Naoya, O. 2011. Ecology of Harmonia axyridis in natural habitats within its native range. Biocontrol, 56(4): 623-641.
  • Pervez, O. 2006. Ecology and biological control application of multicoloured Asian ladybird, Harmonia axyridis: a review. Biocontrol Science and Technology, 16(2): 111-128.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Harmonia axyridis is a host species for a variety of parasites and parasitoids, specifically from the orders Diptera (Strongygaster triangulifer) and Hymenoptera (Dinocampus coccinellae, Oomyzus scaposus, Homalotylus terminalis, Pachyneuron altiscuta). Mites of the genus Coccipolipus, protozoans (such as Microsporidia), nematodes, and fungal species (Hesperomyces virescens, Beauveria bassiana) may also use it as a host species.

Outside its native range, this species can create severe ecological pressures on indigenous Coccinellidae species as they out-compete and utilize resources efficiently. Some of the species most affected are Coccinella transversoguttata, Adalia bipunctata, and Coccinella novemnotata, although others have certainly experienced pressures, as well. They also prey on herbivorous pest species, which helps maintain plant species.

Commensal/Parasitic Species:

  • Kindlmann, P., O. Ameixa, A. Dixon. 2011. Ecological effects of invasive alien species on native communities, with particular emphasis on the interactions between aphids and ladybirds. Biocontrol, 56(4): 469-476.
  • Lombaert, E., T. Guillemaud, J. Comuet, T. Malausa, B. Facon, A. Estoup. 2010. Bridgehead effect in the worldwide invasion of the biocontrol harlequin ladybird. Public Library of Science, 5: e9743. Accessed July 12, 2012 at http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0009743.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Many species of bird prey on Harmonia axyridis. The pentatomid, Podisus maculiventris is known to prey on H. axyridis, as well as many species of ants, including the red imported fire ant, Solanopsis invicta. Interspecies predation also occurs, though only when the other coccinellids are larger than the H. axyridis prey. Cannibalism on eggs and larvae is very prevalent among Harmonia axyridis populations, with some studies showing up to 50% cannibalism of eggs.

To defend itself, Harmonia axyridis produces isopropyl methoxy pyrazine (IPMP), which it secretes from its tarsi when agitated. This is highly concentrated in the hemolymph and is used as a chemical defense mechanism. Further, this species has antimicrobial agents in its hemolymph that provide defense against Gram-positive and Gram-negative bacteria as well as yeast. This species displays aposematism, as its red and black elytra can deter predators, acting as an apparent warning sign.

Known Predators:

Anti-predator Adaptations: aposematic

  • Riddick, E., T. Cottrell, K. Kidd. 2009. Natural enemies of the Coccinellidae: parasites, pathogens, and parasitoids. Biological Control, 51(2): 306-312.
  • Saito, T., S. Bjørnson. 2008. Effects of a microsporidium from the convergent lady beetle, Hippodamia convergens Guérin–Méneville (Coleoptera: Coccinellidae), on three non-target coccinellids. Journal of Invertebrate Pathology, 99(3): 294-301.
  • Firlej, A., G. Boivin, E. Lucas, D. Coderre. 2005. First report of Harmonia axyridis Pallas being attacked by Dinocampus coccinellae Schrank in Canada. Biological Invasion, 7: 553-556.
  • Gross, J., A. Eben, I. Mueler. 2010. A well protected intruder: the effective antimicrobial defense of the invasive ladybird Harmonia axyridis. Journal of Chemical Ecology, 36(11): 1180-1188.
  • Katsoyannos, P., M. Aliniazee. 1998. First record of Strongygaster triangulifera (Loew) (Diptera: Tachinidae) as a parasitoid of Harmonia axyridis (Pallas) (Coleoptera: Coccinellidae) in western North America. The Canadian Entomologist, 130: 905-906.
  • Nalepa, C., K. Kidd, K. Ahlstrom. 1996. Biology of Harmonia axyridis (Coleoptera: Coccinellidae) in winter aggregations. Annals of the Entomological Society of America, 89(5): 681-685.
  • Nalepa, C., A. Weir. 2007. Infection of Harmonia axyridis (Coleoptera: Coccinellidae) by Hesperomyces virescens (Ascomycetes: Laboulbeniales): role of mating status and aggregation behavior. Journal of Invertebrate Pathology, 94: 196-203.
  • Roy, H., P. Brown, P. Rothery, R. Ware, M. Majerus. 2008. Interactions between the fungal pathogen Beauveria bassiana and three species of coccinellid: Harmonia axyridis, Coccinella septempunctata and Adalia bipunctata. Biocontrol, 53: 265-276.
  • Sloggett, J., A. Magro, F. Verheggen. 2011. Chemical ecology of Harmonia axyridis. Biocontrol, 56(4): 643-661.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Like many insects, Harmonia axyridis communicates via vision and chemical/sensory signals through the release of various pheromones. Many pheromones are used for mating signals, as is the case with many insects. They also use these pheromones to detect other individuals for congregation and hibernation during the winter months. While researchers have found the effects that these pheromones have on behaviors, no research has been done regarding their identification. One identified pheromone, harmonine, is used for defense against predators. Harmonine is produced when attacked and is secreted by reflex bleeding from tarsal joints. Prey are generally found using sight or olfactory detection.

Communication Channels: visual ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; chemical

  • Evans, E. 2003. Searching and reproductive behavior of female aphidophagous ladybirds (Coleoptera: Coccinellidae): a review. European Journal of Entomology, 100(1): 1-10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Harmonia axyridis is holometabolous, progressing from egg through four larval instars, to pupa and then adult. The mean duration of each immature stage is as follows: egg - 2.8 days, first instar - 2.5 days, second instar - 1.5 days, third instar - 1.8 days, fourth instar - 4.4 days, pupa - 4.5 days. The diet of the beetle is also known to have an effect on larval development and adult weight, as is temperature. Harmonia axyridis is generally considered bivoltine in much of the world, although up to four or five generations per year have been observed. Adults diapause over winter and start laying eggs in early spring, whenever average temperatures begin to reach 12°C.

Development - Life Cycle: metamorphosis ; diapause

  • El-Sebaey, I., A. El-Gantiry. 1999. Biological aspects and description of different stages of Harmonia axyridis (Pallas) (Coleoptera: Coccinellidae). Bulletin of the Faculty of Agriculture, Cairo University, 50: 87-97.
  • Kindlmann, P., H. Yasuda, S. Sato, K. Shinya. 2000. Key life stages of two predatory ladybird species (Coleoptera: Coccinellidae). European Journal of Entomology, 97: 495-499.
  • LaMana, M., J. Miller. 1998. Temperature-dependent development in an Oregon population of Harmonia axyridis (Coleoptera: Coccinellidae). Environmental Entomology, 27: 1001-1005.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

In its native range, Harmonia axyridis generally has two generations per year, but in some places five generations have been observed. Adults tend to live 30 to 90 days, contingent on temperature, although some have lived over three years. Whichever generation receives cues to diapause will generally live through winter, with reproduction then occurring in spring.

Range lifespan

Status: wild:
3 (high) years.

Typical lifespan

Status: wild:
30 to 90 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Harmonia axyridis secretes pheromones to attract mates and at close distances may use sight. Reproduction is sexual, with internal fertilization of the ova. Studies show that many females are selective of male mates, often deciding on their mates based on the color of male elytra. This seems to be a selective preference, as certain morphs tend to evade predation more effectively. Even so, the species is generally polgynandrous, with individuals ultimately mating many times with many different individuals. After mating, males do not exhibit any apparent defense mechanisms to ensure the eggs are fertilized.

Mating System: polygynandrous (promiscuous)

Females of Harmonia axyridis will produce many eggs per season, averaging an approximate rate of 25 eggs per day. Individuals tend to lay egg clusters, with numbers ranging between 20 and 30 eggs per cluster. This species will breed continuously during its lifetime. Breeding is contingent on temperature, with lower temperatures increasing pre-mating and pre-oviposition periods. Females may lay unfertilized eggs along with the fertilized eggs, which are used by larvae as food sources in conditions where aphids and scale insects are scarce.

Breeding interval: Individuals will breed often and continuously over the duration of adulthood.

Breeding season: Harmonia axyridis will start to breed as soon as temperatures increase beyond approximately 12°C (50°F).

Range eggs per season: 1642 to 3819.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

There is virtually no parental investment in this species aside from females depositing nutrients in eggs. Additionally, females may lay unfertilized eggs along with the fertilized eggs, ensuring a food source for the larvae upon hatching. Otherwise, larval individuals are independent, surviving on their own after hatching.

Parental Investment: pre-hatching/birth (Provisioning: Female)

  • Hodek, I. 1996. Ecology of Coccinellidae. New York, NY: Dordecht, Kluwever Academic.
  • El-Sebaey, I., A. El-Gantiry. 1999. Biological aspects and description of different stages of Harmonia axyridis (Pallas) (Coleoptera: Coccinellidae). Bulletin of the Faculty of Agriculture, Cairo University, 50: 87-97.
  • Hodek, I., P. Ceryngier. 2000. Sexual activity in Coccinellidae (Coleoptera): a review. European Journal of Entomology, 97: 449-456.
  • Koch, R. 2003. The multicolored Asian lady beetle, Harmonia axyridis: a review of its biology, uses in biological control, and non-target impacts. Journal of Insect Science, 32(3): 1-16.
  • LaMana, M., J. Miller. 1998. Temperature-dependent development in an Oregon population of Harmonia axyridis (Coleoptera: Coccinellidae). Environmental Entomology, 27: 1001-1005.
  • Osawa, N. 1993. Population field studies of the aphidophagous ladybird beetle Harmonia axyridis (Coleoptera: Coccinellidae): life tables and key factor analysis. Researches on Population Ecology, 35: 335-348.
  • Perry, J., B. Roitberg. 2005. Ladybird mothers mitigate offspring starvation risk by laying trophic eggs. Behavioral Ecology and Sociobiology, 58(6): 578-586.
  • Stathas, G., P. Eliopoulos, D. Kontodimas, J. Giannopapas. 2001. Parameters of reproductive activity in females of Harmonia axyridis (Coleoptera: Coccinellidae). European Journal of Entomology, 98: 547-549.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Harmonia axyridis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATACCTTTTATTTGGAATATGGGCAGGAATAGTAGGAACATCGTTAAGTATTTTAATTCGGTTAGAATTAGGAACTAGAGGAAGATTAATTGGAAAC---GACCAAATTTATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGAAATTGGTTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCATTTCCACGATTAAATAACATAAGATTTTGACTTTTACCCCCTGCTTTAACTCTTTTAATTTTAAGAACAATCGTAGAAATAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTTTGACCCAACCGGTGGGGGAGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Harmonia axyridis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 231
Specimens with Barcodes: 319
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Harmonia axyridis has no special conservation status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Harmonia axyridis can cause significant economic damages on fruit crops, specifically grapes. This species will crawl inside them to feed and, when the grapes are harvested, will reflex bleed, causing an unpleasant taste. This taste can even be detected in wine if H. axyridis is accidentally incorporated during the wine-making process. It is also known to nip humans when handled.

Negative Impacts: injures humans (bites or stings); crop pest

  • Botezatu, A., Y. Kotseridis, D. Inglis, G. Pickering. 2013. Occurrence and contribution of alkyl methoxypyrazines in wine tainted by Harmonia axyridis and Coccinella septempunctata. Journal of the Science of Food and Agriculture, 93/4: 803-810.
  • Galvan, T., E. Burkness, R. Koch, W. Hutchinson. 2009. Multicolored Asian lady beetle (Coleoptera: Coccinellidae) activity and wine grape phenology: Implications for pest management. Environmental Entomology, 38(6): 1563-1574.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Harmonia axyridis serves as a biological control species for many agricultural crops, as their main dietary sources are major agricultural pests. Their worldwide introduction is due to their intense predatory nature.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Harmonia axyridis

Harmonia axyridis is a large coccinellid beetle. Its colour ranges from yellow-orange to black, and the number of spots between none and 22. It is native to eastern Asia, but has been artificially introduced to North America and Europe to control aphids and scale insects. It is now common, well known, and spreading in those regions, and has also established in South Africa and widely across South America.

It is commonly known as the harlequin ladybird (because it occurs in numerous colour forms). It is also known in North America as the multicolored Asian lady beetle, and (because it invades homes in October in preparation for overwintering) as Halloween lady beetle.[1][2] In Japan, it is not generally distinguished from the seven-spot ladybird which is also common there.

When the species first arrived in the UK, it was labelled in jest as "the many-named ladybird", because among the names listed were: multivariate, southern, Japanese, and pumpkin ladybird.[3]

Description[edit]

Underside (ventral) of Multi Colored Asian Lady Bird

Harmonia axyridis is a "typical" coccinellid beetle in shape and structure, being domed and having a "smooth" transition between its elytra (wing coverings), pronotum, and head. It occurs in three main color forms: red or orange with black spots (known as form succinea); black with four red spots (form spectabilis); and black with two red spots (form conspicua). However, numerous other forms have also been recorded, particularly in the native range. The beetle is typically large for a coccinellid (5.5–8.5 mm long) and even more dome-shaped than native European species. These characteristics distinguish H. axyridis from native species in the UK.

A useful informal clue for distinguishing this species from most other Coccinellidae is that the pronotum of the succinea colour forms of Harmonia axyridis has white markings that typically define an "M"-shaped black area, as seen on a beetle resting head-upwards (or "W"-shaped if it is head-down).[4][5] This is most obvious in the common 19 spot form, less obvious in some of the less common varieties,[6] but works well a rule of thumb. They always have reddish-brown legs and are obviously brown on the underside of the abdomen, even in the melanic colour forms.[2]

Range[edit]

H. axyridis is native to eastern Asia from central Siberia, Kazakhstan, and Uzbekistan in the west, through Russia south to the Himalayas and east to the Pacific coast and Japan, including Korea, Mongolia, China, and Taiwan. As a voracious predator, it was identified as a biocontrol agent for aphids and scale insects. Consequently, it has been introduced into greenhouses, crop fields, and gardens in many countries, including the United States and parts of Europe. The species is now established in the United States, Canada, Argentina, Brazil, the United Kingdom, Denmark, the Netherlands, Belgium, Luxembourg, France, Germany, the Czech Republic, Hungary, Poland, and South Africa.[2]

North America[edit]

typical H. axyridis specimen from northern California

This species became established in North America as the result of introductions into the United States in an attempt to control the spread of aphids. In the last three decades, this insect has spread throughout the United States and Canada, and has been a prominent factor in controlling aphid populations. In the US, the first introductions took place as far back as 1916. The species repeatedly failed to establish in the wild after successfully controlling aphid populations, but an established population of beetles was observed in the wild near New Orleans, Louisiana, around 1988. In the following years, it quickly spread to other states, being occasionally observed in the Midwest within five to seven years and becoming common in the region by about 2000. The species was also established in the Northwest by 1991, and the Northeast by 1994, aided by additional introductions from the native range, rather than just reaching there from the Southeast. Reportedly, it has heavily fed on soybean aphids (which recently appeared in the US after coming from China), supposedly saving farmers vast sums of money in 2001.

Worldwide propagation[edit]

Worldwide routes of propagation of H. axyridis have been described with genetic markers in 2010.[7] The populations in eastern and western North America originated from two independent introductions from the native range.[7] The South American and African populations both originated independently from eastern North America.[7] The European population also originated from eastern North America, but with substantial genetic admixture with individuals of the European biocontrol strain (estimated at about 40%).[7]

This species is widely considered to be one of the world’s most invasive insects,[8][9] partly due to their tendency to overwinter indoors and the unpleasant odor and stain left by their bodily fluid when frightened or squashed, as well as their tendency to bite humans.[8] In Europe it is currently increasing to the detriment of indigenous species,[8] its voracious appetite enabling it to outcompete and even eat other ladybirds.[8] The harlequin ladybird is also highly resistant to diseases that affect other ladybird species and carries microsporidian parasite to which it is immune but that can infect and kill other species.[9] Native ladybird species have experienced often dramatic declines in abundance in areas invaded by H. axyridis.[10]

In addition to its household pest status[citation needed], it has been reported to be a minor agricultural pest contaminating crops of tender fruits and grapes[11] in Iowa, Ohio, New York State, and Ontario.[12] The contamination of grapes by this beetle has been found to alter the taste of wine.[13]

Biology and behavior[edit]

H. axyridis becomes dormant in cooler months, though it will move around whenever the temperature reaches about 10 °C (50 °F). Because the beetles will use crevices and other cool, dry, confined spaces to overwinter, significant numbers may congregate inside walls if given a large enough opening.

These beetles make some use of pheromones to "call" each other, allowing for the large gatherings often seen in the autumn. This is exploited by the makers of H. axyridis traps. However, many cues are visual, both at long (picking out light-coloured structures that are distinct from their surroundings) and short (picking out pre-existing aggregations to join) ranges, while nonvolatile long-chain hydrocarbons laid down by previous aggregations also play a significant role in site selection. Both are more important than volatile pheromones.

They often congregate in sunlit areas because of the heat available, so even on fairly cold winter days, some of the hibernating beetles will "wake up" because of solar heating. These large populations can be problematic because they can form swarms and linger in an area for a long time. These beetles can form groups that tend to stay in upper corners of windows. This beetle has been also found to be attracted to dark screening material for its warmth. This beetle has good eyesight, and will come back from where it was removed, and is known to produce a small bite if provoked.[14]

H. axyridis, like other lady beetles or ladybirds, uses isopropyl methoxy pyrazine as a defensive chemical to deter predation, but also contains this chemical in its hemolymph at much higher concentrations than many other such species, along with species/genus-specific defensive compounds such as harmonine. These insects will "reflex bleed" when agitated, releasing hemolymph from their legs. The liquid has a foul odour (similar to that of dead leaves) and can cause stains. Some people have allergic reactions, including allergic rhinoconjunctivitis when exposed to these beetles.[1] Sometimes, the beetles will bite humans,[1] presumably in an attempt to acquire salt, although many people feel a pricking sensation as a lady beetle walks across the skin, which is just the pressure from the ladybird's feet. Bites normally do no more harm than cause irritation, although a small number of people are allergic to bites.[15]

These beetles can be difficult to identify because of their variations in color, spot size, and spot count of the elytra. The easiest way to identify H. axyridis f. succinea is to look at the pronotum and see if the black markings look like a letter "W" or "M" (depending on if the marking is viewed from the front or the back). Usually, more white is on the pronotum in this species than in most native North American species, though this is not useful if not comparing to North American species.

Control[edit]

Numerous methods of control have been investigated in areas where this beetle has been introduced and causes a threat to native species and biodiversity and to the grape industry. Methods of control include insecticides, trapping, removal of aggregates of beetles, and mechanically preventing entry to buildings.[16] Methods under development involve the investigation of natural parasites and pathogens, including the use of parasitic sexually transmitted mites and fungal diseases.[17]

H. axyridis traps are available that contain the pheromones used by the beetles to attract each other into large gatherings. The best methods for dealing with them in private homes involve sealing openings they may enter.[18] Sweeping and vacuuming are considered effective methods for removing them from homes, though this should be done carefully so as not to trigger reflex bleeding. A nylon stocking placed inside the vacuum cleaner's hose, secured with a rubber band, allows the beetles to be "bagged" rather than collected inside the machine.[19] A trap designed for indoor use was developed which attracts the beetles with a light and seals them in a removable bag, though as the beetles are not strongly attracted to light, this does not work particularly well.[18]

Potential source of medicinal compounds[edit]

H. axyridis secretes a number of defensive compounds, one of which, harmonine (17R,9Z-1,17-diaminooctadec-9-ene), which is present in H. axyridis haemolymph, has been found to display broad-spectrum antimicrobial activity that includes human pathogens. Antibacterial activity is most pronounced against fast-growing mycobacteria and Mycobacterium tuberculosis, and the growth of both chloroquine-sensitive and resistant Plasmodium falciparum strains is also inhibited.[20]


References[edit]

  1. ^ a b c R. L. Koch (2003). "The multicolored Asian lady beetle, Harmonia axyridis: A review of its biology, uses in biological control, and non-target impacts" (PDF). Journal of Insect Science 3: 32. PMC 524671. PMID 15841248. 
  2. ^ a b c "The Harlequin Ladybird Survey". July 20, 2009. Retrieved July 3, 2010. 
  3. ^ Ladybird Survey page "Harmonia axyridis (Pallas) in Britain" [1] Accessed 7 Jan 2008
  4. ^ http://www.harlequin-survey.org/recognition_and_distinction.htm Harlequin Ladybird Survey - Recognition and Distinction
  5. ^ http://bugguide.net/node/view/397 Bugguide
  6. ^ http://www.biocontrol.entomology.cornell.edu/predators/Harmonia.html Cornell University
  7. ^ a b c d Eric Lombaert, Thomas Guillemaud, Jean-Marie Cornuet, Thibaut Malausa, Benoît Facon & Arnaud Estoup (2010). "Bridgehead Effect in the Worldwide Invasion of the Biocontrol Harlequin Ladybird". In Chave, Jerome. PLoS ONE 5 (3): e9743. doi:10.1371/journal.pone.0009743. PMC 2840033. PMID 20305822. 
  8. ^ a b c d http://www.harlequin-survey.org/factfile/concern.htm
  9. ^ a b http://www.nature.com/news/invasive-ladybird-has-biological-weapon-1.13011
  10. ^ Russell F. Mizell III (2007). "Impact of Harmonia axyridis (Coleoptera: Coccinellidea) on native arthropod predators on pecan and crape myrtle" (PDF). Florida Entomologist 90 (3): 524–536. doi:10.1653/0015-4040(2007)90[524:IOHACC]2.0.CO;2. ISSN 0015-4040. JSTOR 4494179. 
  11. ^ "Midwest Grape Production Guide Bulletin 919-05". Retrieved 2011-01-31. 
  12. ^ Betty Summerhayes (July 6, 2007). "OMAFRA Achievements in Crop Technology 2007". Government of Ontario. Archived from the original on January 16, 2011. Retrieved June 24, 2011. 
  13. ^ Gary Pickering, James Lin, Roland Riesen, Andrew Reynolds, Ian Brindle & George Soleas. "Influence of Harmonia axyridis on the sensory properties of white and red wine". American Journal of Enology and Viticulture 55 (2): 153–159. 
  14. ^ "Multicolored Asian Ladybeetle (Harmonia axyridis)". 
  15. ^ "Medscape". Archived from the original on November 7, 2007. Retrieved August 18, 2006. 
  16. ^ Marc Kenis, Helen E. Roy, Renate Zindel & Michael E. N. Majerus (2008). Current and potential management strategies against H. axyridis. "From Biological Control to Invasion: the Ladybird Harmonia axyridis as a Model Species". BioControl 53 (1): 235–252. doi:10.1007/s10526-007-9136-7. 
  17. ^ Helen Elizabeth Roy, Peter M. J. Brown, Peter Rothery, Remy L. Ware & Michael E. N. Majerus (2008). Interactions between the fungal pathogen Beauveria bassiana and three species of coccinellid: Harmonia axyridis, Coccinella septempunctata and Adalia bipunctata. "From Biological Control to Invasion: the Ladybird Harmonia axyridis as a Model Species". BioControl 53 (1): 265–276. doi:10.1007/s10526-007-9122-0. 
  18. ^ a b "USDA site". Ars.usda.gov. Retrieved 2010-07-03. 
  19. ^ "Ohio State University Extension Fact Sheet". Ohioline.osu.edu. Retrieved 2010-07-03. 
  20. ^ http://rsbl.royalsocietypublishing.org/content/early/2011/09/14/rsbl.2011.0760.full
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!