Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Photuris pennsylvanica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGTGCTTGATCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAGACCTGGATCCTTAATTGGAAATGATCAAATTTTTAATGTTATTGTAACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAGTACCTCTAATACTTGGGGCCCCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCCTCTATTACTCTTCTTTTAATAAGAAGAATAGTTGAAAGAGGGGCTGGTACTGGTTGAACTGTTTACCCCCCACTATCTGCTAATTTAGCTCATAGAGGAGCATCTGTTGATTTAGCTATTTTTAGATTACACTTAGCTGGAATTTCTTCAATTTTAGGAGCAGTAAATTTTATTTCAACTATTGCAAATATACGACCAATTGAAATAAAGCTCGACCAAATACCTTTATTTGTTTGAGCTGTTCTTATTACAGCCGTACTATTACTTTTATCTCTCCCAGTTTTAGCTGGTGCTATTACTATACTATTAACTGACCGTAATTTAAATTCTTCATTCTTTGATCCGGCAGGAGGTGGAGATCCAATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Photuris pennsylvanica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Photuris pennsylvanica

Photuris pennsylvanica, known by the common names Pennsylvania firefly, lightning bug,[2] Pennsylvania lightning bug,[3] and (in its larval state) glowworm,[4] is a species of firefly from the United States and Canada.[2][4]

Contents

Description

P. pennsylvanica is a somewhat flattened beetle approximately 0.75 inch (2 cms) in length. Its primary color is black, but it has two bright-red eyespots on its thorax, as well as yellow edging on its thorax and wing case. The species is carnivorous, and feeds mostly on insects, but also on other invertebrates, such as land snails on occasion. The terminal segments of its abdomen are white-yellow and glow when the insect manifests its bioluminescence.[5]

State insect

In 1974, P. pennsylvanica was designated the state insect of Pennsylvania.[2] Its designation as such started with a group of Highland Park Elementary School students in Upper Darby, Pennsylvania.[6] Fireflies are abundant in Pennsylvania and are enjoyed for their ability to "transform a midsummer night into a fairyland of tiny, brilliant twinkling lights"[2] rather than being considered pests.[6] Discovering there was a species of firefly with the taxon pennsylvanica, and no other U.S. state had adopted a firefly as its state insect, the students began their campaign to have P. pennsylvanica made Pennsylvania's state insect.[2][6]

With advice and support from state legislators, the students began a campaign that included letter writing, the circulation of petitions, and the distribution of bumper stickers. On April 10, 1974, Governor Milton J. Shapp signed their bill, making the Pennsylvania firefly their state's official insect. A few years later, Highland Park Elementary School was presented with a bronze plaque in honor of the students' achievement. [6]

According to one source,[citation needed] Pennsylvanians best know fireflies as "lightning bugs", and may have confused "firefly" with "black fly" when that state was plagued by them in 1988.[5] This might be why that year the legislature again confirmed the Pennsylvania firefly's official status and specified it by scientific name so that:

The Firefly is the state insect, as enacted by the General Assembly on April 10, 1974. Act 130 of December 5, 1988, designated the particular species of firefly, "Poturis Pensylvanica De Geer" as the official state insect.[7]

The firefly is also the state insect of Tennessee, but in this case the specific species referred to (if any) may be Photinus pyralis, the most common species of firefly in North America.[8]

One-second exposure of fireflies flashing in a field in Indiana County, Pennsylvania

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!