Ecology

Associations

In Great Britain and/or Ireland:
Foodplant / parasite
Rhizidiopsis emmanuelensis parasitises Nitzschia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Nitzschia (Nitzschia sp. (large)) is prey of:
Argia vivida
Enallagma anna
Ophiogomphus severus
Baetis tricaudatus
Hyalella azteca
Hydropsyche occidentalis
Simulium argus
Tricorythodes minutes
Aphrophila noevaezelandiae
Austrosimulium australense
Naonella
Tanytarsini
Coloburiscus humeralis
Helicopsyche albescens
Hydora nitida
Oligochaeta I
Oligochaeta II
Pycnocentrodes evecta
Zealolessica cheira
Amphipoda
Orthocladiinae
Maoridiamesea
Eukiefferiella
Podonomus
Polypedellum
Deleatidium
Oligochaeta type weak-long-short
Oxyethira albiceps
Potamopyrgus antipodarum
Scirtidae
Aoteapsyche
Austroclima jollyae
Ceratopogonidae
Cricotopus II
Stictocladius
Hudsonema amabilis
Nesameletus ornatus
Oniscigaster
Orchymontia
Paranephrops zealandicus
Podaena
Potamopurgus antipodarum
Stratiomyidae
Baraeoptera roria
Diamesid Blond
Eriopterini
Hydraena homolaena
Olinga feredayi
Pycnocentrodes
Eukiefferiella Shiny Black
Orthoclad Blue Black
Orthoclad Blue Blond
Chironomid type Polyped
Chironomid type Slant-eye
Corynoneura
Tanytarsini II
Hydrobiosella stenocerca
Orychmontia
Pycnocentria
Tanyderidae
Zelandoperla
Zephlebia spectabilis
Pirara
Cricotopus I
Tabanidae
Austraclima jollyae
Tanytarsini I
Hexatomini
Hydraena homalaena
Hydrobiosella
Paroxyethira eatoni/hintoni
Zelandoperlinae
Acroperla
Austroperla cyrene
Olinga feredayii

Based on studies in:
USA: Idaho-Utah, Deep Creek (River)
New Zealand: Otago, Blackrock, Lee catchment (River)
New Zealand: Otago, Broad, Lee catchment (River)
New Zealand: South Island, Canton Creek, Taieri River, Lee catchment (River)
New Zealand: Otago, Dempster's Stream, Taieri River, 3 O'Clock catchment (River)
New Zealand: Otago, Healy Stream, Taieri River, Kye Burn catchment (River)
New Zealand: Otago, Kye Burn (River)
New Zealand: Otago, Little Kye, Kye Burn catchment (River)
New Zealand: Otago, Stony, Sutton catchment (River)
New Zealand: Otago, Sutton Stream, Taieri River, Sutton catchment (River)
New Zealand: Otago, German, Kye Burn catchment (River)

This list may not be complete but is based on published studies.
  • D. G. Koslucher and G. W. Minshall, 1973. Food habits of some benthic invertebrates in a northern cool-desert stream (Deep Creek, Curlew Valley, Idaho-Utah). Trans. Amer. Micros. Soc. 92:441-452, from pp. 446-50.
  • Townsend, CR, Thompson, RM, McIntosh, AR, Kilroy, C, Edwards, ED, Scarsbrook, MR. 1998. Disturbance, resource supply and food-web architecture in streams. Ecology Letters 1:200-209.
  • Thompson, RM and Townsend, CR. 1999. The effect of seasonal variation on the community structure and food-web attributes of two streams: implications for food-web science. Oikos 87: 75-88.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nitzschia aff. Dissipata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nitzschia aff. Dissipata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Nitzschia cf. ovalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nitzschia cf. ovalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Nitzschia cf. promare

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATATCTTATTTTTGGTGGTATTGCTGGTGTAGCAGGTACCGCTTTATCTTTATACATAAGAATAACATTATCTCAACCAAATGGTAGTTTTTTAGAATACAATCATCATTTATATAATGTAATTGTAACAGGTCATGCTTTTGTTATGATTTTTTTTATGGTGATGCCTGTTTTAATCGGTGGTTTTGGGAACTGGTTTGTTCCTTTAATGATAGGTGCTCCCGATATGGCTTTTCCTAGAATGAATAATATTAGTTTTTGGTTACTGCCACCATCTCTTTTATTGTTAATCGAATCTGTGCTTTGTGAAGCCGGGGTTGGTACTGGTTGGACAGTTTACCCTCCTTTATCGGGTATTATCGCTCACTCTGGTGGTGCTGTTGATTTAGCTATTTTCAGTTTACACCTTTCAGGTGCTGCTTCTATTTTAGGTGCAATTAATTTTATCTGTACAATTGTAAATATGAGAACTGAGAGTTTGCCATTCCACAAATTACCTTTATTTGTATGGTCAGTGTTTTTAACAGCAATTCTTTTATTATTATCTTTACCTGTATTAGCAGGTGCCATCACAATGTTATTGACTGATCGGAATTTTAATACAACTTTTTTTGACCCAGCAGGTGGTGGTGATCCCGTTCTTTACCAGCATTTATTTTGGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nitzschia cf. promare

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Nitzschia cf. laevis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nitzschia cf. laevis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Nitzschia cf. incrustans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nitzschia cf. incrustans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Nitzschia cf. sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATATTTAATTTTTGCTGCAATTTCTGGGCTAGCAGGTACCGCTTTATCTCTGTATATCCGAATCACTTTAGCAAGTCCTAATTCAAGTTTTTTAGATTATAATCACCACTTATATAATGTTATTGTAACAGGTCATGCATTCTTAATGATTTTTTTCTTAGTAATGCCCGCATTAATTGGTGGTTTTGGTAACTGGTTTGTTCCATTAATGATTGGAGCGCCCGATATGGCTTTTCCTCGAATGAATAATATTAGTTTTTGGTTACTGCCACCCTCATTACTTTTATTAATAGGATCTGTTCTTTGTGAAGCAGGTGTCGGTACTGGTTGGACTGTGTATCCTCCATTGTCAAGTGTCACAGCTCACTCTGGTGGGGCTGTGGATTTAGCTATTTTTAGTCTACACCTTTCAGGAGCAGCATCTATTTTAGGTGCAATTAATTTTATCTGTACCATTACTAATATGAGATCAAAAAGTTTGCCTTTCCATAGGCTACCTCTATTCGCTTGGTCAATTTTTATTACCGCTTTCCTATTACTTTTATCATTACCTGTTTTAGCAGGAGCAATTACTATGCTATTAACAGATAGAAATTTCAATACTACTTTCTTCGACCCAGCAGGAGGTGGAGATCCTGTTTTATACCAGCATCTTTTCTGGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nitzschia cf. sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Nitzschia cf. pusilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nitzschia cf. pusilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:64Public Records:36
Specimens with Sequences:102Public Species:20
Specimens with Barcodes:39Public BINs:6
Species:28         
Species With Barcodes:22         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Nitzschia

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nitzschia

Nitzschia is a common pennate marine diatom. In the scientific literature this genus is sometimes termed Nitzchia, this taxon has many species described, which all have a similar morphology.

Contents

Occurrence

Nitzschia is found mostly in colder waters, and is associated with both Arctic and Antarctic polar sea ice where it is often found to be the dominant diatom. Nitzschia includes several species of diatoms known to produce the neurotoxin known as domoic acid, a toxin which is responsible for the human illness called amnesic shellfish poisoning. The species N. frigida is found to grow exponentially even at temperatures between −4 and −6 degrees Celsius.[1] Some Nitzchia species are also extremophiles by dent of tolerance to high salinity; for example, some halophile species of Nitzchia are found in the Makgadikgadi Pans in Botswana.[2]

Species

See also

References

  1. ^ L. Aletsee and J.Jahnke, 'Growth and productivity of the psychrophilic marine diatoms Thalassiosira antarctica Comber and Nitzschia frigida Grunow in batch cultures at temperatures below the freezing point of sea water. Polar biol(1992) 11:643-647>
  2. ^ C. Michael Hogan (2008) Makgadikgadi, The Megalithic Portal, ed. A. Burnham
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!