Overview

Brief Summary

Biology

Both adults and larvae of this beetle are voracious predators, taking a wide range of prey including fish. They actively search for prey, and periodically swim to the surface in order to take in air (3). Adults often fly at night, and may land on glass surfaces or roads, mistaking them for water (2). When threatened, they exude a foul-smelling fluid from the anus that deters potential predators from eating them (5). Females lay their eggs in cavities, which they cut in the stems of water plants that protrude from the water. The eggs hatch after a number of weeks (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The great diving beetle is, as the name suggests, a large aquatic beetle (4). It is has a beautifully streamlined body shape and is dark brown to blackish in colour with yellow legs and a yellow border around both the head and the thorax. The wing cases, or 'elytra', are ridged in females but smooth in males. Males can also be distinguished from females by the presence of suction pads on the front legs; two of which are very large. The brownish larvae have large heads, which bear impressive, large jaws (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found in Europe and northern Asia and is common in Britain (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

These aquatic diving beetles have bodies that are compressed top to bottom and keeled laterally and ventrally. They have hydrodynamic bodies and average 27mm in length.

Range mass: 30 (high) g.

Other Physical Features: ectothermic ; bilateral symmetry

  • Crowson, R. 1981. The Biology of the Coleoptera. New York: Academic Press.
  • van Nostrand, B. 1972. Grzimeck's Animal Life Encyclopedia: Insecta. New York: Reinnold Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Dytiscus marginalis do not exist below certain elevations and are found in mountain lakes or ponds or in collections of melted snow. Adults hibernate under stones to avoid being frozen in the water during colder seasons. (Evans and Bellamy 1996) These beetles are active anywhere by the ice, where they exploite the oxygen bubbles that usually occur under ice along with dissolved oxygen.(Crowson 1981)

Terrestrial Biomes: tundra ; mountains

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This water beetle is common in most aquatic habitats, in both still and running water (3), and frequently occurs in garden ponds. It is scarcer in chalk and limestone areas (1), and seems to prefer ponds with plenty of weeds (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Beetles of this family eat on several aquatic animals, including fish! Adults and larva are very carnivorous and search for their prey by diving and swimming actively through zones in the water where light reaches. (Borror and White 1970, Gullan and Cranstan 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Mating occurs in or near water by the Dytiscids. Beetles of this species undergo a complete metamorphosis. Eggs are laid underwater and are usually placed in special cavities cut in the stems of emergent plants (Crowson 1981). Eggs hatch within a few weeks (McCafferty 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dytiscus marginalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTAATATTAGGAGCTCCAGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTCTCCCGCCTTCTTTAACTTTATTATTAATAAGAAGAATAGTAGAAAGAGGGGCAGGAACAGGTTGAACAGTTTATCCCCCTCTTTCAGCAAGAATTGCCCATGGGGGGGCTTCAGTAGATTTAGCTATTTTTAGATTACATTTAGCTGGGGTTTCTTCTATTTTAGGGGCTGTGAATTTTATTACAACAATTATTAATATACGATCAGTAGGAATAACTTTAGACCGAATACCTTTATTTGTTTGATCAGTAGGAATTACAGCTCTTTTACTATTATTATCATTGCCAGTATTAGCAGGGGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCAGCCGGAGGGGGGGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGACACCCAGAAGTTTATATTTTAATTCTTCCAGGGTTTGGAATAATTTCTCACATTATTAGACAAGAAAGAGGAAAAAAGGAAACTTTTGGTTCTCTAGGTATAATTTATGCTATATTAGCAATTGGTCTATTAGGATTTGTTGTATGAGCACATCATATATTTACTGTAGGAATAGATGTAGACACACGGGCATATTTTACTTCTGCTACTATAATTATTGCTGTACCCACAGGAATTAAAATTTTTTCTTGGTTAGCAACTCTTCATGGATCT---CAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dytiscus marginalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

European scientists are trying to extend protection to the Dytiscus marginalis beetles and other water beetles by going further than just restricting collection. The Water Beetle Specialist Group and the Saproxylic Invertebrate Project are two organizations that have been hard at work fostering the education, biodiversity, and conservation of the water beetle.

(Evans and Bellamy 1996)

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Common (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This beetle is very common and is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Great diving beetle

Adult
Larva

The great diving beetle, Dytiscus marginalis, is a large aquatic diving beetle native to Europe and northern Asia, and is particularly common in England. The great diving beetle, true to its name, is a rather sizable insect. The larvae can grow up to 60 mm in length, while the adults are generally between 27-35 mm.

These beetles live in fresh water, either still or slow-running, and seem to prefer water with vegetation. They are dark-coloured (brown to black) on their back and wing cases (elytra) and yellow on their abdomen and legs. The male's wing cases are shiny, while those of the female are finely grooved. A voracious predator, this beetle hunts a wide variety of prey, including other insects, tadpoles, and small fish.

They are able fliers, usually at night, when they use the reflection of moonlight to locate new water sources, this location method can sometimes cause them to land on wet roads or other hard wet surfaces.

Before they dive, they collect air bubbles in their wing cases which goes through the spiracles. The jaws of a great diving beetle are strong compared to their body size.

Illustrated and described in detail as Plate 99, British Entomology by John Curtis (entomologist) (published London, 1814-39) labelled "Dyticus dimidiatus"


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!