Overview

Comprehensive Description

Description

Geographic Status: Nea

Locality: Native, New World. Canada- BC, QC; USA- AK, CA, OR, WA.

Common Name: Narrow-collared Snail-eating Beetle

Synonyms: Cychrus angusticollis Fischer von Waldheim, 1823; Pemphus angusticollis nigripennis Roeschke, 1907, Scaphinotus angusticollis olympiae Van Dyke, 1944

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Erwin, Terry

Source: Western Hemisphere Caraboidea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Macrohabitat: Lowlands to midlands, subalpine zone, sea level- 1387 meters altitude, in forests (coniferous, mixed, and deciduous), and cultivated fields. Microhabitat: Shaded moist ground often along streams. Dispersal abilites: brachypterous, hence flightless, thus vagility limited to walking or running. Seasonal occurance: Adults have been found in March-November. Teneral adults in May-July, and September. Behavior: Nocturnal, gregarious (up to 50 individuals in or under a single log). Adults are predaceous on snails, slugs, earthworms, and spiders. Taking cover during the day mostly in rotten fallen trees and tree-stumps, under the loose bark and moss of dead standing and fallen trees, in hollow tree roots, also under fallen trees and boards, among dead leaves with other debris. Frequent climber on shrubs, tree-stumps, and fallen trees up to 20 m above ground while foraging. Adults have been found over wintering in old tree-stumps and fallen trees. Sometimes found in and around human settlements. (Erwin, 2001; Gidaspow, 1973; Larochelle & Lariviere, 2003; Data from NMNH, UASM collections)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Erwin, Terry

Source: Western Hemisphere Caraboidea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scaphinotus angusticollis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTGTATTTTATTTTTGGTGCTTGATCTGGAATAGTAGGTACTTCTTTAAGTATGCTTATTCGAGCTGAGTTAGGAAATCCTGGGTCACTAATTGGTGAT---GACCAAATCTATAATGTTATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGACTTGTACCTTTAATATTAGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAATATAAGTTTTTGGTTATTACCCCCTTCATTAACCCTTTTACTGATGAGCAGAATAGTTGAAAGAGGGGCGGGTACAGGATGAACTGTCTATCCCCCGCTTTCTTCTGGAATTGCCCACAGAGGAGCCTCCGTAGATCTTGCAATTTTTAGATTACATTTAGCAGGGGTTTCATCTATTCTAGGAGCAGTAAATTTTATTACTACAATTATTAATATACGATCAATTGGAATAACATTTGATCGAATACCATTATTTGTTTGAAGTGTAGGTATTACTGCATTATTGCTTCTTTTATCTTTACCTGTATTAGCTGGAGCAATTACTATACTTCTTACTGATCGGAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGTGGAGACCCAATTCTATACCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATTATTAGCCAAGAAAGAGGAAAGAAAGAAACCTTTGGTTCATTGGGAATAATTTATGCTATATTAGCCATTGGTTTACTTGGATTTGTTGTTTGAGCTCATCATATATTTACAGTTGGTATGGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Scaphinotus angusticollis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!