Overview

Comprehensive Description

melanariusPterostichusCarabidaePolyphagaColeopteraEndopterygotaPterygotaInsectaArthropodaAnimalia

Pterostichus melanarius (Illiger, 1798)

Notes

Holoartic. Eurytopic. Pteridimorphic, with winter larvae. Large size. Predator.

Common in the study area (n = 869). Recorded in all habitat categories.

  • Pilon, Nicola, Cardarelli, Elisa, Bogliani, Giuseppe (2013): Ground beetles (Coleoptera: Carabidae) of rice field banks and restored habitats in an agricultural area of the Po Plain (Lombardy, Italy). Biodiversity Data Journal 1, 972: 972-972, URL:http://dx.doi.org/10.3897/BDJ.1.e972
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

melanariusPterostichusCarabidaePolyphagaColeopteraEndopterygotaPterygotaInsectaArthropodaAnimalia

Pterostichus melanarius (Illiger, 1798)

Notes

Holoartic. Eurytopic. Pteridimorphic, with winter larvae. Large size. Predator.

Common in the study area (n = 869). Recorded in all habitat categories.

  • Pilon, Nicola, Cardarelli, Elisa, Bogliani, Giuseppe (2013): Ground beetles (Coleoptera: Carabidae) of rice field banks and restored habitats in an agricultural area of the Po Plain (Lombardy, Italy). Biodiversity Data Journal 1, 972: 972-972, URL:http://dx.doi.org/10.3897/BDJ.1.e972
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Foodplant / feeds on
Pterostichus melanarius feeds on seed of Fragaria x ananassa
Other: minor host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterostichus melanarius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CGAATAAATAATATAAGTTTTTGACTTCTTCCTCCTTCATTAACTCTTCTTTTAATGAGAAGTATAGTTGAAAGTGGAGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCTTCAGGAATTGCCCATGCTGGAGCTTCAGTTGATTTGGCTATTTTTAGACTACATTTAGCCGGAGTATCATCTATTTTAGGAGCTGTAAATTTTATTACTACAATTATTAATATACGATCAATTGGAATAACTTTTGATCGAATACCATTATTTGTTTGATCAGTAGGTATTACTGCTTTATTATTATTACTTTCATTACCTGTATTAGCAGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTTTTTGACCCAGCTGGAGGAGGAGACCCGATTTTATATCAACATTTATTTTGATTTTTTGGCCATCCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pterostichus melanarius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 47
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!