Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Arctic Shrews prefer grassy clearings and marshes within coniferous forests and are never very dense in population. Mortality is high early in life. About one in every seven youngsters dies within a month after it leaves the nest, and 80 percent die before reaching sexual maturity. Maximum life span is about 18 months. Due to their habitat preferences, Arctic Shrews have not been well studied, especially in the more northern part of their range. It is thought that their vision may be quite good, because of their behavior when hunting insects. Like other shrews, they are almost frantically active, pursuing prey around the clock to meet their high energy needs, with short rests between hunting bouts.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Kerr, R., 1792.  The animal kingdom, or zoological system, of the celebrated Sir Charles Linnaeus.  (Class I. Mammalia: containing a complete systematic description, arrangement, and nomenclature, of all known species and varieties of Mammalia, or animals which suck to their young; being a translation of that part of Systema Naturae, as lately published, with great improvements, by Professor Gmelin of Goettingen), p. 206.  644 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Southern Yukon and Northwest territories to eastern Quebec, Canada; North Dakota, South Dakota, Minnesota, Michigan, and Wisconsin (Kirkland and Schmidt 1996, Stewart et al. 2002, Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs from Yukon and Northwest Territory to Quebec in Canada; southwards to North Dakota, South Dakota, Minnesota, Michigan, and Wisconsin in the United States (Hutterer, in Wilson and Reeder 1993; Kirkland and Schmidt 1996). The disjunct populations in Nova Scotia and New Brunswick have now been elevated to species status (S. maritimensis).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Arctic shrews are found in North America, from the Arctic Circle to the northern United States. They occur in North and South Dakota, Wisconsin, Michigan, and Minnesota. The eastern limits of the species range are in Quebec and the Atlantic Maritime provinces, and the western limits are in the southern Yukon and Mackenzie valleys.

Biogeographic Regions: nearctic (Native )

  • Churchfield, S. 1990. The Natural History of Shrews. Ithaca, NY: Cornell University Press.
  • Kirkland, G., D. Schmidt. 1996. Sorex arcticus. Mammalian Species, 524: 1-5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Arctic shrews, Sorex arcticus, are native to North America. Their distribution ranges as from the Arctic Circle in the north and as far south as the northern United States, into North and South Dakota, Wisconsin, Michigan, and Minnesota. Their eastern limits are in eastern Quebec and the Atlantic Maritime provinces, and their western limits are the southern Yukon and Mackenzie valleys.

Biogeographic Regions: nearctic (Native )

  • Churchfield, S. 1990. The Natural History of Shrews. Ithaca, NY: Cornell University Press.
  • Kirkland, G., D. Schmidt. 1996. Sorex arcticus. Mammalian Species, 524: 1-5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Arctic shrews are medium-sized shrews with cylindrical bodies. The head is long with a pointed nose, like other shrews. The hair is short and soft, the eyes and ear pinnae are all very small, and the tail is long.

The coloring of arctic shrews is distinctive. The body has three colors of fur, which is most evident during the winter. On the back, from the head to the tail, the fur is very dark brown or black. The sides are a lighter brown. Finally, the belly is a grayish brown. The top of the tail is dark brown which grades into light brown towards under side of the tail.

Arctic shrews molt once per year. The three colored bands of the fur are more distinct during the winter months, from October to June. Winter fur is thicker and brighter thna sumer fur. The banded fur pattern is less developed in juveniles than it is in adults.

Arctic shrews have thirty-two teeth. Their teeth have brownish-red pigment on the tips.

Range mass: 5.3 to 13.5 g.

Range length: 100 to 125 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Clough, G. 1963. Biology of the Arctic Shrew, Sorex arcticus. American Midland Naturalist, 69: 69-81.
  • Buckner, C. 1964. Metabolism, food capacity, and feeding behavior in four species of shrews. Canadian Journal of Zoology, 42: 259-279.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Arctic shrews are medium-sized shrews with cylindrical bodies. The head is long with a pointed nose, like other shrews. The hair is short and soft, the eyes and ear pinnae are all very small, and the tail is long.

The mass of S. arcticus ranges from 5.3 to 13.5 g. Total length ranges from 100 to 125 mm. Tail length ranges from 36 to 45 mm. The hind foot length ranges from 12 to 15 mm.

The most distinctive physical characteristic of Sorex arcticus is its coloring. The fur is tri-colored, which is most evident during the winter months. On the dorsal side, from the head to the base of the tail, the fur is very dark brown to black in color. The sides are a lighter brown, and the ventral side of the body is a grayish brown. The tail is bi-colored; the dorsal side of the tail is dark brown and gradually becomes a light brown towards the ventral side.

Arctic shrews show slight seasonal variation in pelage. Tri-color bands are more distinct during the winter months, from October to June. Like others in the genus Sorex, arctic shrews molt twice a year. Winter fur is thicker and brighter. Summer fur is less insulative and paler. Also, the banded fur pattern is less developed in juveniles.

The dental formula for Sorex is I 3/1, C 1/1, P 3/1, M 3/3, with thirty-two teeth total. Teeth have a brownish-red pigment on the tips. Sorex arcticus, like other Sorex, possesses unicuspid teeth after the canines. Arctic shrews have four unicuspids; the first two unicuspids are large and equal in size, and the third is smaller than the first two, but larger than the fourth.

The metabolic rate of S. arcticus falls between the smaller masked shrew and the larger northern short-tailed shrew. The estimated minimal metabolic rate in S. arcticus is 4.7 kcal per day.

Range mass: 5.3 to 13.5 g.

Range length: 100 to 125 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Clough, G. 1963. Biology of the Arctic Shrew, Sorex arcticus. American Midland Naturalist, 69: 69-81.
  • Buckner, C. 1964. Metabolism, food capacity, and feeding behavior in four species of shrews. Canadian Journal of Zoology, 42: 259-279.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 13 cm

Weight: 11 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Average: 114.7 mm
Range: 100-124 mm

Weight:
Average: 8.1 g
Range: 5-13.5 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

See Carraway (1995) for a key to western North American soricids based primarily on dentaries.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Most commonly found in grass-sedge marshes, wet meadows, and other moist openings in and adjacent to boreal forest. Also present, in fewer numbers, in tamarack-spruce bogs and cedar swamps. Small globular nests are usually made above ground under logs or other material.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is most commonly found in grass-sedge marshes, wet meadows, and other moist openings in and adjacent to boreal forest. It is also present, in fewer numbers, in tamarack-spruce bogs and cedar swamps. Small globular nests are usually made above ground under logs or other material. In the south, breeding occurs in late winter to mid-summer. Gestation lasts three weeks and litter size is five to nine, with an average of three litters per year. Young-of-the-year may breed in the first summer in some areas (Baird et al. 1983).

The species' home range is around 1/4 acre (Buckner 1966). Populations fluctuate annually from less than one to four per acre (Buckner 1966). High population turnover, with approximately 80% of each generation dead prior to sexual maturity (Buckner 1966). The arctic shrew is dependent nearly exclusively on insects. Destructive sawfly larvae seasonally constitute a large part of their diet (Buckner 1964). It is active day and night and like many shrews, major activity peaks at night.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic shrews can be found in a variety of habitats, but populations are highest in moist grassy areas near lakes, bogs, swamps, and ditches. In the Upper Peninsula of Michigan, arctic shrew populations are the densest in spruce and tamarack swamps, as well as near lakes and streams.

These shrews are often found in forest clearings as well as marshes. Other occasional habitats include dry fields, old fields, mixed conifer swamps, dense grasses adjacent to ditches, mixed grasses, strawberries and ferns at forest clearings, alder thickets, and dry marsh with grasses, sedge hammocks, forbs, cattail, willow, and red-osier shrubs.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian

  • Baker, R. 1983. Michigan Mammals. Detroit: Michigan State University Press.
  • Kurta, A. 1998. Mammals of the Great Lakes Region. Ann Arbor: The University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sorex arcticus occupies a variety of habitats, but populations are highest in moist grassy areas near lakes, bogs, swamps, and ditches. Specifically, in the Upper Peninsula of Michigan, arctic shrew populations are the densest in spruce and tamarack swamps, as well as near lakes and streams. They are often found in clearings in boreal forests, as well as marshes. Other occasional habitats include dry fields, old fields, mixed conifer swamps, dense grasses adjacent to ditches, mixed grasses, strawberries and ferns at forest clearings, alder thickets, and dry marsh with grasses, sedge hammocks, forbs, cattail, willow, and red-osier shrubs.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian

  • Baker, R. 1983. Michigan Mammals. Detroit: Michigan State University Press.
  • Kurta, A. 1998. Mammals of the Great Lakes Region. Ann Arbor: The University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Dependent nearly exclusively on insects. Destructive sawfly larvae seasonally constitute a large part of its diet (Buckner 1964)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Arctic shrews eat insects. Pristiphora erichsonii are a major source of food. Arctic shrews also eat grasshoppers such as Melanoplus femurrubrum. They often feed on insect larvae and pupae, as well as adults, and sometimes eat other invertebrates. Aquatic insects are also eaten, since arctic shrews sometimes live near streams and bog banks. In captivity, arctic shrews eat dead Microtus, fly pupae, and mealworms.

Arctic shrews usually hunt for food on the ground, but will also climb plants. They have been seen attacking adult 'grasshoppers Melanoplus_ferumrubrum' by climbing up. then pouncing on the prey, seizing it with jaws and feet.

Animal Foods: mammals; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms

  • Buckner, C. 1970. Direct observation of shrew predation on insects and fish. The Blue Jay, 28: 171-172.
  • Jackson, H. 1961. Mammals of Wisconsin. Madison: Wisconsin Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Arctic shrews are insectivorous. Larch sawflies make up a large proportion of the diet. Arctic shrews also eat grasshoppers such as redlegged grasshoppers. Generally, they feed on insect larvae, pupae, and adults, and occasionally other invertebrates. Aquatic insects are also consumed, since arctic shrews sometimes reside near streams and bog banks. In captivity, arctic shrews consume dead voles, fly pupae, and mealworms.

Sorex arcticus usually forages on the ground, but will also climb plants. Arctic shrews exhibit hunting behavior, preying on grasshoppers. Sorex arcticus has been observed to attack adult Melanoplus ferumrubrum grasshoppers by climbing approximately 31 cm and pouncing on the prey, seizing it with jaws and feet.

Animal Foods: mammals; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms

Primary Diet: carnivore (Insectivore )

  • Buckner, C. 1970. Direct observation of shrew predation on insects and fish. The Blue Jay, 28: 171-172.
  • Jackson, H. 1961. Mammals of Wisconsin. Madison: Wisconsin Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Arctic shrews may have a role in regulating insect pest populations.

In regions where Sorex_arcticus and S._cinereus distributions overlap, population sizes are found to be inversely related to each other, suggesting direct competition.

Sorex_arcticus associates with many other small mammals. The most common and frequent ecological associations occur with Sorex cinereus, Microtus pennsylvanicus, and Blarina brevicauda. Other small mammal species that share habitats with arctic shrews are Sorex palustris, Sorex hoyi, Peromyscus maniculatus, Clethrionomys gapperi, Phenacomys intermedius, Synaptomys cooperi, Zapus hudsonius, Mustela erminea, Tamias striatus, Tamias minimus, and Tamiasciurus hudsonicus.

Arctic shrews are susceptible to various ectoparasites. These include hypopial mites (Labidophorus_soricis), larval ticks (Ixodes_muris), myobiid mites (Proomyobia_breviseosus and Amorphacarus_elongatus), laelapid mites (Androlaelops_fahrenholzi), ixodid ticks (Haemaphysalis_leporispalustris and Ixodes_murinus), Parasitoidea ticks (Euhaemogamasus_liponyssoides and Monyssus_jamesoni), trombiculid mites (Trombicula_harperi) and other Trombicula, myobid mites (Amorphacarus_henegerorum), pyemotid mites in the genus Resinacaris, and fleas (Corrodopsylla_curvata).

Commensal/Parasitic Species:

  • hypopial mites (Labidophorus_soricis)
  • larval ticks (Ixodes_muris)
  • myobiid mite (Proomyobia_breviseosus)
  • myobiid mite (Amorphacarus_elongatus)
  • laelapid mites (Androlaelops_fahrenholzi)
  • ixodid tick (Haemaphysalis_leporispalustris)
  • ixodid tick (Ixodes_murinus)
  • Parasitoidea tick (Euhaemogamasus_liponyssoides)
  • Parasitoidea tick (Monyssus_jamesoni)
  • trombiculid mites (Trombicula_harperi)
  • myobid mites (Amorphacarus_henegerorum)
  • pyemotid mites (Resinacaris)
  • fleas (Corrodopsylla_curvata)

  • Whitaker, J., D. Pascal. 1971. External parasites of the arctic shrew in Minnesota.. Journal of Mammalogy, 52: 202.
  • Lawrence, W., K. Hays, S. Graham. 1965. Arthropodous ectoparasites from some northern Michigan mammals. Occasional Papers of the Museum of Zoology, University of Michigan, 639: 1-7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

A defense strategy of arctic shrews is excreting a musky scent from its flank glands, a strategy also used in other Soricidae species. Arctic shrews also remain under cover most of the time and are colored in a waywhich helps to hide them.

The only known predators of arctic shrews are owls. The remains of an arctic shrew have been found in a Bubo virginianus pellet.

Known Predators:

  • great horned owls (Bubo_virginianus)

Anti-predator Adaptations: cryptic

  • Nelson, A. 1934. Notes on Wisconsin mammals. Journal of Mammalogy, 15: 252-253.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Arctic shrews may have a role in regulating insect pest populations.

In regions where Sorex arcticus and S. cinereus distributions overlap, population sizes are found to be inversely related to each other, suggesting direct competition.

Sorex arcticus associates with many other small mammals. The most common and frequent ecological associations occur with masked shrews, meadow voles, and northern short-tailed shrews. Other small mammal species that share habitats with arctic shrews are water shrews, pygmy shrews, deer mice, southern red-backed voles, heather voles, southern bog lemmings, meadow jumping mice, ermines, eastern chipmunks, least chipmunks, and red squirrels.

Arctic shrews are susceptible to various ectoparasites. These include hypopial mites (Labidophorus soricis), larval ticks (Ixodes scapularis), myobiid mites (Proomyobia breviseosus and Amorphacarus elongatus), laelapid mites (Androlaelops fahrenholzi), ixodid ticks (Haemaphysalis leporispalustris and Ixodes murinus), Parasitoidea ticks (Euhaemogamasus liponyssoides and Monyssus jamesoni), trombiculid mites (Trombicula harperi) and other Trombicula, myobid mites (Amorphacarus henegerorum), pyemotid mites in the genus Resinacaris, and fleas (Corrodopsylla curvata).

Commensal/Parasitic Species:

  • hypopial mites (Labidophorus soricis)
  • larval ticks (Ixodes scapularis)
  • myobiid mite (Proomyobia breviseosus)
  • myobiid mite (Amorphacarus elongatus)
  • laelapid mites (Androlaelops fahrenholzi)
  • ixodid tick (Haemaphysalis leporispalustris)
  • ixodid tick (Ixodes murinus)
  • Parasitoidea tick (Euhaemogamasus liponyssoides)
  • Parasitoidea tick (Monyssus jamesoni)
  • trombiculid mites (Trombicula harperi)
  • myobid mites (Amorphacarus henegerorum)
  • pyemotid mites (Resinacaris)
  • fleas (Corrodopsylla curvata)

  • Whitaker, J., D. Pascal. 1971. External parasites of the arctic shrew in Minnesota.. Journal of Mammalogy, 52: 202.
  • Lawrence, W., K. Hays, S. Graham. 1965. Arthropodous ectoparasites from some northern Michigan mammals. Occasional Papers of the Museum of Zoology, University of Michigan, 639: 1-7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

A defense strategy of arctic shrews is excreting a musky scent from its flank glands, a strategy also used in other shrew species. Arctic shrews also remain under cover most of the time and are colored in a waywhich helps to hide them.

The only known predators of arctic shrews are owls. The remains of an arctic shrew have been found in a great horned owl pellet.

Known Predators:

Anti-predator Adaptations: cryptic

  • Nelson, A. 1934. Notes on Wisconsin mammals. Journal of Mammalogy, 15: 252-253.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Home range is around 1/4 acre (Buckner 1966). Populations fluctuate annually from less than 1 to 4 per acre (Buckner 1966). High population turnover, with approximately 80% of each generation dead prior to sexual maturity (Buckner 1966)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Shrews have limited visual ability. The eyes of shrews are very small, and the optic region of the shrew brain is small.

Shrews lack fully ossified auditory bullae, but they can produce and perceive sounds in high frequencies. Calls are made for defense and courtship, and calls are also made because of fright.

No information is available specifically for arctic shrews, but in general the most developed sense in shrews is the ability to smell. These shrews are probably similar, relying on scents to identify foods and other shrews.

Shrews are not able to see very well. Their eyes are very small. The brain of shrews is not wired to allow a lot of complex information from the eyes to be interpreted. Arctic shrews probably do not rely greatly on visual signals, although these may play some role in interactions between individuals.

Shrews can make and hear sounds in high frequencies. Calls are made for defense and courtship. They are also made when an shrew is afraid.

Touch is probably important to shrews. Mothers touch their young, and mates touch each other.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

  • LeGros, C. 1932. The brain of Insectivora. Proceedings of the Zoological Society of London: 975-1013.
  • Baron, G., H. Frahm, K. Bhatnagar, H. Stephan. 1983. Comparison of brain structure volumes in Insectivora and Primates III Main olfactory bulb (MOB). J. Hirnforsch, 24: 551-568.
  • Hutterer, R. 1985. Anatomical adaptations of shrews. Mammal Review, 15: 43-55.
  • Branis, M., H. Burda. 1994. Visual and hearing biology of shrews. Pp. 189-200 in J Merritt, G Kirkland, R Rose, eds. Advances in the Biology of Shrews, Special Publication no. 18. Pittsburgh: Carnegie Museum of Natural History.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

No information is available specifically for S. arcticus, but in general, olfaction is the strongest and most developed sense in shrews. A large portion of a shrew's brain is devoted to olfaction.

Shrews have limited visual ability. The eyes of shrews are very small, and the optic region of the shrew brain is small.

Shrews lack fully ossified auditory bullae, but they can produce and perceive sounds in high frequencies. Calls are made for defense and courtship, and calls are also made because of fright.

Touch is probably important to shrews. Mothers touch their young, and mates touch each other.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

  • LeGros, C. 1932. The brain of Insectivora. Proceedings of the Zoological Society of London: 975-1013.
  • Baron, G., H. Frahm, K. Bhatnagar, H. Stephan. 1983. Comparison of brain structure volumes in Insectivora and Primates III Main olfactory bulb (MOB). J. Hirnforsch, 24: 551-568.
  • Hutterer, R. 1985. Anatomical adaptations of shrews. Mammal Review, 15: 43-55.
  • Branis, M., H. Burda. 1994. Visual and hearing biology of shrews. Pp. 189-200 in J Merritt, G Kirkland, R Rose, eds. Advances in the Biology of Shrews, Special Publication no. 18. Pittsburgh: Carnegie Museum of Natural History.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active day and night. Like many shrews, major activity peaks at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, individual arctic shrews can live as long as 18 months. The juvenile mortality rate is approximately 50% during the first month.

Average lifespan

Status: wild:
18 months.

  • Buckner, C. 1966. Populations and ecological relationships of shrews in tamarack bogs of southwestern Manitoba. Journal of Mammalogy, 47: 181-194.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

In the wild, individual arctic shrews can live as long as 18 months. The juvenile mortality rate is approximately 50% during the first month.

Average lifespan

Status: wild:
18 months.

  • Buckner, C. 1966. Populations and ecological relationships of shrews in tamarack bogs of southwestern Manitoba. Journal of Mammalogy, 47: 181-194.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: It has been suggested that, in the wild, these animals have a shorter lifespan than similar species with individuals living up to 1.5 years (Kirkland and Schmidt 1996). Little is known about their longevity in captivity.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In south, breeding occurs late winter to mid-summer. Gestation lasts 3 weeks. Litter size is 5-9; average of 3 litters per year. Young-of-the-year may breed in first summer in some areas (Baird et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although the mating system of arctic shrews is not known for certain, it is likely that they are promiscuous like other shrews.

Mating System: polygynandrous (promiscuous)

The breeding season can occur from April to August, but may be shorter in the north of the species' range. Arctic shrew females give birth to 1 or 2 litters each year. Litters range from 4 to 10 offspring, with an average of 7 young per litter. Shrews are pregnant for between 13 and 21 days. Females nurse their young for 20 to 24 days. Both female and male arctic shrews reach sexual maturity after one year.

Breeding interval: Arctic shrew females give birth to one or two litters each year.

Breeding season: Breeding occurs from February to August, varying with latitude.

Range number of offspring: 4 to 10.

Range gestation period: 13 to 21 days.

Range weaning age: 20 to 24 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average number of offspring: 6.57.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Newborn arctic shrews are helpless. They remain with and are cared for by their mother until the end of the weaning period. The young stay with their mother until 5 to 6.5 weeks after conception. Males play no role in parental care.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Baker, R. 1983. Michigan Mammals. Detroit: Michigan State University Press.
  • Clough, G. 1963. Biology of the Arctic Shrew, Sorex arcticus. American Midland Naturalist, 69: 69-81.
  • Muller, A., U. Thalmann. 2000. Origin and evolution of primate social organization: a reconstruction.. Biological Review, 75: 405-435.
  • Baird, D., R. Timm, G. Nordquist. 1983. Reproduction in the arctic shrew, Sorex arcticus . Journal of Mammalogy, 64: 298-301.
  • Kirkland, G., D. Schmidt. 1996. Sorex arcticus. Mammalian Species, 524: 1-5.
  • Stockley, P., J. Searle. 1994. Characteristics of the breeding season in the common shrew (Sorex araneus): male sexual maturation, morphology and mobility. Pp. 181-188 in J Merritt, G Kirkland, R Rose, eds. Advances in the Biology of Shrews, Special Publication no. 18. Pittsburgh: Carnegie Museum of Natural History.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No information is available on the mating system of S. arcticus. However, most shrews mate promiscuously. During the breeding season, males compete for reproductive females and in doing so, move farther from their home ranges than females. It is likely that S. arcticus is similar.

Mating System: polygynandrous (promiscuous)

In Wisconsin, the breeding season is from February to August. The breeding season is shorter in more northern areas, from April to August. Arctic shrew females give birth to 1 or 2 litters each year. Litter sizes range from 4 to 10 offspring, with an average of 7 offspring per litter. The gestation period ranges between 13 and 21 days. The lactation period ranges between 20 and 24 days. The time from conception to weaning lasts between 5 and 6.5 weeks. Both female and male arctic shrews reach sexual maturity after one year.

Breeding interval: Arctic shrew females give birth to one or two litters each year.

Breeding season: Breeding occurs from February to August, varying with latitude.

Range number of offspring: 4 to 10.

Range gestation period: 13 to 21 days.

Range weaning age: 20 to 24 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average number of offspring: 6.57.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Newborn arctic shrews are helpless. They remain with and are cared for by their mother until the end of the weaning period. The young stay with their mother until 5 to 6.5 weeks after conception. Males play no role in parental care.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Baker, R. 1983. Michigan Mammals. Detroit: Michigan State University Press.
  • Clough, G. 1963. Biology of the Arctic Shrew, Sorex arcticus. American Midland Naturalist, 69: 69-81.
  • Muller, A., U. Thalmann. 2000. Origin and evolution of primate social organization: a reconstruction.. Biological Review, 75: 405-435.
  • Baird, D., R. Timm, G. Nordquist. 1983. Reproduction in the arctic shrew, Sorex arcticus . Journal of Mammalogy, 64: 298-301.
  • Kirkland, G., D. Schmidt. 1996. Sorex arcticus. Mammalian Species, 524: 1-5.
  • Stockley, P., J. Searle. 1994. Characteristics of the breeding season in the common shrew (Sorex araneus): male sexual maturation, morphology and mobility. Pp. 181-188 in J Merritt, G Kirkland, R Rose, eds. Advances in the Biology of Shrews, Special Publication no. 18. Pittsburgh: Carnegie Museum of Natural History.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sorex arcticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATATAGTATTTGGAGCCTGAGCCGGAATAGTAGGGACAGCCCTGAGTATTTTAATTCGTGCTGAACTAGGCCAACCAGGTGCTCTACTAGGTGATGACCAGATCTATAACGTCATTGTAACCGCCCACGCATTTGTTATAATTTTCTTTATAGTTATACCAATCATGCTTGGAGGGTTTGGAAACTGACTAATCCCTTTAATGATTGGTGCACCAGACATAGCATTCCCACGAATANATAATATAAGCTTCTGACTACTCCCACCATCATTCCTCCTATTATTAGCCTCATCAACCGTCGAAGCAGGAGCAGGCACTGGCTGAACTGTCTACCCCCCATTGGCCGGTAATCTAGCTCATGCGGGAGCATCTGTTGATTTAGCAATTTTCTCTCTCCACCTAGCAGGTGTTTCATCTATTCTGGGGTCAATCAATTTCATTACCACAATTATTAATATAAAACCCCCTGCTATATCTCAATATCAAACACCACTATTCGTATGATCAGTTCTAATTACAGCAGTACTTCTTCTTCTCTCACTCCCAGTTCTTGCAGCCGGTATTACTATACTTTTAACGGATCGTAACCTTAACACTACTTTCTTCGATCCTGCCGGAGGGGGAGATCCGATTCTTTACCAACATCTTTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sorex arcticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern because it is a very widespread and abundant species with no known threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic shrews are abundant in suitable habitats throughout their range.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic shrews are abundant in suitable habitats throughout their range.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a widespread and abundant species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Very beneficial to foresters due to its heavy dependence upon sawflies and other insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse affects of Sorex_arcticus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive effects of Sorex_arcticus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse affects of Sorex arcticus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive effects of Sorex arcticus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Arctic shrew

The Arctic shrew (Sorex arcticus), also known as the blackback shrew or saddlebacked shrew, is a medium-sized shrew found in Canada and the northern United States. Separate species status has been proposed for the maritime shrew (Sorex maritimensis) which is found in New Brunswick and Nova Scotia and had been considered to be a subspecies of the Arctic shrew. The tundra shrew (Sorex tundrensis) was formerly considered to be a subspecies of the Arctic shrew.

Physical description[edit]

The Arctic shrew is most distinctive in its tricolored fur. It is dark brown or black on its back from its head to the base of its tail, while its flanks are a lighter brown, and its underside is lighter still grayish brown. Even its tail is bi-colored, dark brown on the dorsal side, and gradually fading to a lighter brown on the ventral side. The fur is grayer in winter time, and its tricolor is most marked during the winter months from October to June, for the fur is thicker and brighter. Arctic shrews molt twice a year, and the tricolor bands in the fur are less prominent in younger shrews.

Its body length ranges from 10 cm to 12 cm including a 4 cm long tail. Its mass may range from 5 g to 13 g and it possesses thirty-two teeth with and average metabolism of 4.7 kilocalories a day.

Distribution and habitat[edit]

Arctic shrews are native to North America, ranging from the Arctic Circle in the north and as far south as the northern United States, into North and South Dakota, Wisconsin, Michigan, and Minnesota. Their eastern limits are in eastern Quebec and the Atlantic Maritime provinces, and their western limits are the southern Yukon and Mackenzie valleys.

Arctic shrews are found in a variety of habitats in highest density of 3 to 5 individuals per acre and each individual arctic shrew appears to limit its range to one tenth of an acre. Of their various habitats, they found in greatest quantity and density in areas near bodies of water, such as lakes, streams, marshes, wetlands, bogs, swamps, ditches or open areas near wetlands. In the Upper Peninsula of Michigan, they are found densely in spruce and tamarack swamps, in addition to other typical habitats. Arctic shrews have been found in clearings in boreal forests, and occasionally in mixed conifer swamps, dry or old fields, dense grasses near ditches, mixed grasses, in the undergrowth of forest clearings, alder thickets, and dry marsh with grasses, sedge hammocks, forbs, cattail, willow, and red-osier shrubs.

Mating and reproduction[edit]

There is little information about the mating habits of the Arctic shrew, however males of most shrew species mate with many females, and compete with other males for females, so the assumption is that arctic shrews behave similarly. In Wisconsin, the breeding season lasts from February to August, and the breeding season is shorter in more northern areas, from April to August. Arctic shrew females give birth to one or two litters each year, and these litters range in size from 4 to 10 offspring, with an average of 7 offspring per litter. The gestation period ranges between 13 and 21 days, so the young stay with their mother until 5 to 6.5 weeks after conception, and males make no contribution to parental care. When they are born, young arctic shrews are helpless. Their mother and are cares for them until the end of the weaning period, 20 to 24 days after birth. Both female and male arctic shrews reach sexual maturity after one year. As much as 50 percent of all juveniles die in the first month, but the average lifespan of an arctic shrew in the wild is around 18 months.

Behavior[edit]

Arctic shrews are solitary animals. Adults are territorial. In one laboratory study, whenever two arctic shrews were placed together in a cage, one was dead within several days, though there was no sign of injury to the dead shrew and the cause for this mortality is unclear, however the result of this forced interaction has been repeatedly observed. Arctic shrews are active during day and night, though there are contradicting reports on levels and cycles of activity throughout the day. One claim is that they are least active during mid-morning, while other reports describe alternating periods of activity and rest, with an average of fourteen periods of activity daily. Arctic shrews are very active and move quickly. Periods of inactivity are spent lying on the ground, either on one side or with the ventral side down, body rolled up, and head tucked under the body. Grooming consists of wiping the forefeet rapidly along the mouth.

Like all shrews, the Arctic shrew has a voracious and insatiable appetite due to its quick metabolism. It eats insects, worms and small invertebrates, with a large proportion of its diet made up of larch sawflies, though arctic shrews in captivity have been fed dead voles fly pupae, and mealworms. The only known predators of arctic shrews are owls.

Subspecies[edit]

There are three subspecies recognized for this species:[1]

See also[edit]

References[edit]

  1. ^ a b Hutterer, R. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 284. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Hammerson, G. (2008). "Sorex arcticus". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 8 February 2010. 
  • Seto, S. and P. Myers (2006). "Sorex arcticus". Animal Diversity Web. Retrieved 16 December 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: S. a. maritimensis Smith is now considered a distinct species, as suggested by Volobouev and van Zyll de Jong (1988). Stewart et al. (2002) studied mitochondrial DNA of a number of Sorex species and found that S. a. martimensis, although it is definitely a sister group to arcticus + laricorum, has diverged substantially from those two taxa. In fact, it has diverged more than other recognized pairs of sister species in Sorex, and the proportion of third-position transversion substitutions between arcticus and maritimensis suggests that these two taxa shared a common ancestor approximately 2.4 million years ago.

Youngman (1975) presented evidence that S. arcticus and S. tundrensis are separate species, a treatment followed by Jones et al. (1992) and Hutterer (in Wilson and Reeder 1993). Palearctic taxa formerly included in S. arcticus represent S. tundrensis, according to Junge et al. (1983) and Hutterer (in Wilson and Reeder 1993), but chromosome data reported by Rausch and Rausch (1993) indicate that tundrensis is limited to the Nearctic (the Eurasian shrews may comprise a complex of sibling species distinct from tundrensis).

Fumagalli et al. (1999) present a phylogenetic analysis of the genus Sorex based on mitochondrial DNA sequences. See George (1988) for an electrophoretic study of systematic relationships among Sorex species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!