Overview

Distribution

Range Description

This species was described from an inexact locality in the “Cape of Good Hope” and shows a narrow distribution along the dry to arid south-western coastline of South Africa, from Bloubergstrand on the northern outskirts of Cape Town to Port Nolloth in Namaqualand, close to the Namibian border (Harrison et al. 2003). The estimated extent of occurrence of this species lies between 13,750 and 22,150 km2, the latter accounting for sea area, the former subtracting sea area as areas of unsuitable habitat. It is likely to have a more restricted area of occupancy of probably no more than 3,000 km2 based on the area of relatively intact habitat in the centre of this species' range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

The species occurs on vegetated soft to firm sand of coastal hummocks and hillocks, the periphery of dune systems, and river beds and banks. It has been recorded in low numbers (0.1 per trap) in West Coast National Park (Davis 1993). At the northern extremes of its range, it is apparently restricted to a narrow coastal strip of cool deep sands, as it was not recorded further inland. This species may show pheromone release behaviour.

This species is found on coastal sands in the southwest part of the Lowland fynbos and renosterveld ecoregion (AT1202) and the Succulent Karoo ecoregion (AT1322) (ecoregions based on Olson et al. 2001).

Some environmental characteristics for 78 locality records are as follows: altitude: mean: 85 ± 75 (S.D.), range: 0.3-308 m; annual rainfall: mean: 144 ± 63 (S.D.), range: 63-300 mm; annual temperature: mean: 17.2 ± 1.1 (S.D.), range: 14.5-18.6oC (max. + min. / 2).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pachysoma hippocrates

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 61 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAAATAATATAAGATTCTGATTATTACCCCCCTCCCTTACTTTTTTATTAATAAGAAGAGCTGTAGAAAACGGGGTTGGTACTGGTTGAACTATCTACCCTCCTTTATCTACTAATATTGCTCATACCGGGGCATCTGTTGATTTA---GCTATTTTTAGCTTACATCTAGCCGGAATTTCATCAATTTTAGGGGCTATTAACTTTATTACAACAATTATCAATATACGATCAATTGGAATAACTTTTGATCGTATACCTTTATTTGCTTGGGCAGTAGGAATTACTGCACTATTATTATTATTATCATTACCAGTATTAGCTGGG---GCTATTACAATATTATTAACAGACCGAAACTTAAATACATCTTTTTTTGACCCTATAGGAGGGGGAGACCCTATTTTATATCAGCATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTCTTCCCGGTTTTGGAATAATTTCTCACATTATTAGCCAAGAAAGAAATAAAAAA---GAAACTTTTGGAACTTTAGGTATAATTTATGCTATAATAACTATTGGGTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAGATGTAGATACTCGTGCCTATTTTACTTCAGCAACAATAATTATTGCTATTCCCACAGGAATTAAAATTTTCAGTTGGTTA---GCCACT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pachysoma hippocrates

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 61
Specimens with Barcodes: 64
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Davis, A.L.V.

Reviewer/s
Böhm, M. & Gerlach, J.

Contributor/s
Hall, D. & Monteiro, L.

Justification

Pachysoma hippocrates has been currently assessed as Least Concern. Although this flightless species has been found only at low population densities within West Coast National Park, this may be representative of population densities throughout its range, which is restricted to an extent of occurrence of between 13,750 and 22,150 km2 and an area of occupancy of probably no more than 3,000 km2. Therefore, by extent of occurrence the species qualifies or very nearly qualifies for the area threshold under criterion B1. The species is experiencing threats and probable declines in range and population size at the southern and northern parts of its range due to habitat conversion by agricultural interests and coastal developments and through habitat degradation from mining interests. Although it does receive some protection from its occurrence within West Coast National Park, surveys are required to ensure that it is sufficiently protected elsewhere to avoid attaining Near Threatened status.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

There are few quantitative population data for this species. However, it has been recorded at low population density in West Coast National Park (Davis 1993).


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Although there are some threats at the extremes of the species range at Bloubergstrand and Port Nolloth much of its intervening range may be relatively intact. In the south, the species may be threatened by habitat modification for urban coastal developments and agriculture whereas in the north it may be threatened by coastal mining for diamonds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are no species-specific conservation actions in place for this species. Although the species may be threatened by coastal developments and farming in the southern part of its range and by coastal mining for diamonds in the northern part of its range, it is protected within the borders of the West Coast National Park and the proposed Groen-Spoeg National Park.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!