Overview

Distribution

Range Description

This species was described from the farm, Nortier, near Lambert's Bay and is localized to a small arid coastal range extending from just north of Lambert’s Bay to the south bank of the Olifants River and then inland up the Olifants River valley as far as Clanwilliam, South Africa (Harrison et al. 2003). The extent of occurrence is estimated to lie somewhere between 1,000 and 1,850 km2, with the area of occupancy estimated as 200 km2. Overall, the species has only been collected from ten localities (thus does not occur at more than ten locations), despite widespread surveys for the genus within the region.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

This large, flightless species has been recorded from firm vegetated sand on the banks of the Olifants and Groot-Sandleegte Rivers and from coastal hummocks, but has not been found associated on or around larger dunes (Harrison et al. 2003). It was observed dragging detritus to pre-constructed burrows using its hind legs to grip the material. Males of this species may release pheromones to attract females to the burrow entrance as a single observation was made of a male in a typical head-down pheromone release stance in which the hind legs were used to stroke the abdominal sternites and then flicked backwards into the air. This action was interspersed by short periods when the hind legs were held outstretched and immobile.

This restricted species range straddles the edges of three ecoregions, the northern edges of the southwest coastal parts of the Lowland fynbos and renosterveld ecoregion (AT1202) and Montane fynbos and renosterveld (AT1203), and the southern edge of the Succulent Karoo (AT1322) (ecoregions based on Olson et al. 2001).

Some environmental characteristics for ten locality records are as follows: altitude: mean: 138 ± 86 (S.D.), range: 37-342 m; annual rainfall: mean: 189 ± 12 (S.D.), range: 171-214 mm; annual temperature: mean: 18.0 ± 0.4 (S.D.), range: 17.5-18.6oC (max. + min. / 2).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pachysoma glentoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAAATAATATAAGATTCTGATTATTACCCCCTTCTCTCACCTTTTTATTAATAAGAAGAATAGTAGAAAGTGGGGCTGGAACTGGTTGAACTGTTTATCCCCCTTTATCAACTAATATCGCCCATACTGGGGCATCTGTTGACCTGGCTATTTTTAGCTTACATTTAGCAGGAATTTCATCAATCTTAGGGGCTATTAACTTTATTACAACAATTATTAATATACGATCAACCGGAATAACTTTTGATCGTATACCTTTATTTGCTTGAGCGGTAGGAATTACTGCATTATTATTATTACTATCATTACCAGTATTAGCTGGAGCTATTACAATATTATTAACAGATCGAAACTTAAATACATCTTTTTTTGACCCTATAGGTGGTGGAGACCCTATTCTATATCAACATCTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTCTCCCTGGGTTTGGAATAATTTCCCATATTATTAGCCAAGAAAGAAATAAAAAAGAAACTTTTGGAACTTTAGGTATAATTTACGCTATAATAACTATTGGATTATTAGGATTTATTGTCTGGGCTCATCATATATTCACAGTAGGGATAGATGTAGATACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pachysoma glentoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(i,ii)+2ab(i,ii)

Version
3.1

Year Assessed
2013

Assessor/s
Davis, A.L.V.

Reviewer/s
Böhm, M. & Gerlach, J.

Contributor/s
Hall, D. & Monteiro, L.

Justification

Pachysoma glentoni has been assessed as Vulnerable. Despite extensive survey data for the genus Pachysoma along the west coast of South Africa, this flightless species was recorded from only six localities (Harrison et al. 2003), subsequently extended to ten localities although these are essentially centred on only four locations. Thus, this species has a restricted range with an estimated extent of occurrence of between 1,000 and 1,850 km2, and an area of occupancy of 200 km2. Both fall within the threshold for a Vulnerable listing under criterion B. Conversion of available habitat to vineyards is the predominant threat to the species. Although at least some parts of the range have not yet been affected, overall, it is likely that conversion to arable farmland has already somewhat reduced the observed extent of occurrence (EOO) and area of occupancy (AOO) of this species. No part of the species' range falls within protected areas and research is suggested to establish the precise habitat affinities of this species to aid conservation action. Any decline in the number of locations is likely to lead to an up-listing of the species to Endangered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no quantitative population data available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats

The area occupied by this species has probably contracted owing to the extensive cultivation of vineyards along the lower Olifants River valley, although parts of the coastal dunes remain relatively unmodified.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are no species-specific conservation actions in place for this species. The species does not currently occur within any proclaimed conservation area. An accurate assessment of the extinction risk of this species requires a survey to determine the area of suitable dune habitat remaining within its range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!