Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Mainly nocturnal and rarely seen, the Cinereus Shrew is nonetheless common and widespread below the timberline in northern deciduous and coniferous forests, in both wet and dry habitats. It is also known as the Masked Shrew and the Common Shrew. Litter size ranges from 4-10, averaging 7. The newborns are about 15-17 mm long and are hairless, with fused eyelids. Their eyes open after 17 or 18 days, and they are weaned at approximately 20 days. The Cinereus Shrew is not distinctly marked. The back is brown, the underside is grayish white, and the tail has a blackish tip.

Links:
Mammal Species of the World
  • Original description: Kerr, R., 1792.  The animal kingdom, or zoological system, of the celebrated Sir Charles Linnaeus.  (Class I. Mammalia: containing a complete systematic description, arrangement, and nomenclature, of all known species and varieties of Mammalia, or animals which suck to their young; being a translation of that part of Systema Naturae, as lately published, with great improvements, by Professor Gmelin of Goettingen), p. 206.  644 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Sorex cinereus, commonly called the Masked shrew or common shrew, is the most widely distributed shrew found in North American. Common shrews occur throughout the northern United States, most of Canada, and Alaska. They do not occur on Vancouver Island, the Queen Charlotte Islands, in tundra habitats, arctic islands, or in extreme northern Quebec. (Nagorsen, 1996; van Zyll de Jong, 1983).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs from Alaska, in the United States, to Labrador/Newfoundland in Canada, south to Washington, Utah, New Mexico, the Northern Great Plains, southern Indiana and Ohio, through the Appalachian Mountains to northern Georgia and western South Carolina, and on the east coast to New Jersey and northern Maryland in the United States (Whitaker, 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Alaska to Labrador/Newfoundland, south to Washington, Utah, New Mexico, the Northern Great Plains, southern Indiana and Ohio, through the Appalachian Mountains to northern Georgia and western South Carolina, and on the east coast to New Jersey and northern Maryland (Laerm et al. 1995, Brimleyana 22:15-21; Whitaker 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Masked shrews are the most widely distributed shrew in North American. They are found throughout the northern United States, most of Canada, and Alaska. They do not occur on Vancouver Island, the Queen Charlotte Islands, in tundra habitats, on arctic islands, or in extreme northern Quebec.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Sorex cinereus is the second smallest shrew species. Sorex hoyi is slightly smaller. Although similar in size, their coloration is quite different. There is no significant sexual dimorphism in common shrews. Dorsal fur is brown, ventral fur is greyish-white. Pelage tends to be darker overall in winter. The tail is brown above and pale underneath, with a blackish tip. Average length of the tail is 39.9mm, comprising over 40% of the total length. Average length of adults is 99 mm. Young are born hairless and with fused eyelids, they weigh from 0.2 to 0.3 grams and are 15 to 17 mm long including a 3 mm long tail (Nagorsen, 1996; Wilson and Ruff, 1999; van Zyll de Jong, 1983).

Range mass: 2.5 to 4.0 g.

Average length: 99.0 mm.

Sexual Dimorphism: sexes alike

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 0.238 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Masked shrews are the second smallest shrew species in North America, pygmy shrews are slightly smaller. Male and female masked shrews are about the same size and color. The fur of their back is almost uniformly brown and their underparts are greyish-white. Their tail is brown above and lighter below, with a black tip. Fur color tends to be darker in the winter. Tail length averages 39.9mm, almost half of their total body length. Average body length of adults is 99 mm.  Young are born hairless and with fused eyelids, they weigh from 0.2 to 0.3 grams and are 15 to 17 mm long including a 3 mm long tail.

Range mass: 2.5 to 4.0 g.

Average length: 99.0 mm.

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.238 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 10 cm

Weight: 5 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Average: 96.6 mm
Range: 75-125 mm

Weight:
Range: 2.2-5.4 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Generally paler and smaller than S. FUMEUS (95-129 mm total length) (Godin 1977). See Hall (1981) for a (somewhat outdated) key to North American species of SOREX. See Carraway (1995) for a key to western North American soricids based primarily on dentaries.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Common shrews occupy a diversity of habitats, most common are open and closed forests, meadows, river banks, lake shores, and willow thickets. Habitat suitability depends on the availability of water and the highest population densities can be found in moist environments. Common shrews also do well in disturbed habitats such as those disturbed by fire or logging. The average home range is 0.6 hectares (Nagorsen, 1996; Pagels, et al. 1994)).

Habitat Regions: temperate

Terrestrial Biomes: forest ; rainforest

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It occupies most terrestrial habitats excluding areas with very little or no vegetation. Thick leaf litter in damp forests may represent favoured habitat, although it appears to be adaptable to major successional disturbances. In Nova Scotia, diet indicated that much foraging was done among wreck on beaches (Stewart et al., 1989). Nest sites are typically in shallow burrows or above ground in logs and stumps. Breeding season may last from March through September (there is evidence of mid-winter births in at least some years in Nova Scotia) (Stewart et al. 1989). There are usually two litters, may be three. Gestation lasts 18 days, and litter size is two to 10 (average around seven). Young are weaned in three weeks. They reach sexual maturity in 20-26 weeks, and some young may breed in the year of their birth.

There are large annual fluctuations in population size. Density estimates range from one to 12 shrews per acre, with a home range of about 0.10 acre. They are usually in scattered, locally abundant populations. It rarely lives past a second summer.

It is a generalist, opportunistic invertivore, and eats primarily insects and other invertebrates, carrion, small vertebrates, occasionally seeds. It consumes daily its own weight in food, and is active throughout the day (and the year) to secure enough food to maintain high metabolic rate. Cloudy, rainy nights increase nocturnal activity.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Occupies most terrestrial habitats excluding areas with very little or no vegetation. Thick leaf litter in damp forests may represent favored habitat, although appears adaptable to major successional disturbances. In Nova Scotia, diet indicated that much foraging was done among wrack on beaches (Stewart et al. 1989). Nest sites are typically in shallow burrows or above ground in logs and stumps.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Masked shrews occupy a wide variety of habitats. They are found in open and closed forests, meadows, along river banks, lake shores, and willow thickets. Preferred habitats are always close to water and the largest numbers of masked shrews can be found in moist environments. Masked shrews also do well in disturbed habitats such as those disturbed by fire or logging. The average home range size is 0.6 hectares.

Habitat Regions: temperate

Terrestrial Biomes: forest ; rainforest

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Because Sorex cinereus inhabits a wide range there is great geographic variation in diet. Ants represent 50% of the food source for common shrews in Michigan, whereas insect larvae are the dominant prey item in New Brunswick. Kelp flies and marine amphipods are major dietary items in Nova Scotia. They are also important predators of forest insect pests such as Jack Pine Budworms and Larch Sawflies. In general, common shrews consume a variety of invertebrates including insect larvae, ants, beetles, crickets, grasshoppers, spiders, harvestmen, centipedes, slugs, snails. Seeds and fungi are also consumed (Nagorsen, 1996).

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: A generalist, opportunistic invertivore. Eats primarily insects and other invertebrates, carrion, small vertebrates, occasionally seeds. Echolocation may be used for detecting prey (Gould et al. 1964). Consumes daily its own weight in food.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Because masked shrews inhabit a wide range there is a lot of variability in their diet. Formicidae represent 50% of the food source for masked shrews in Michigan. In other areas they eat mostly insect larvae. In general, masked shrews consume a variety of invertebrates including Insecta, Formicidae, Coleoptera, Gryllidae, Orthoptera, Araneae, Opiliones, Chilopoda, Gastropoda. They are also important predators of forest insect pests such as jack pine budworms and larch sawflies. Seeds and fungi are also eaten occasionally.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Masked shrews can be very abundant in the communities in which they live. They can have a dramatic impact on insect communities because they have to consume such large quantities of insects. They are also important prey items for many small predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Masked shrews avoid being preyed upon by staying under cover and being active mostly at night, they are rarely seen.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Masked shrews can be very abundant in the communities in which they live. They can have a dramatic impact on insect communities because they have to consume such large quantities of insects. They are also important prey items for many small predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Masked shrews avoid being preyed upon by staying under cover and being active mostly at night, they are rarely seen.

Known Predators:

  • weasels (Mustela)
  • hawks (Accipitridae)
  • falcons (Falconidae)
  • owls (Strigiformes)
  • domestic cats (Felis_silvestris)
  • red foxes (Vulpes_vulpes)
  • snakes (Serpentes)
  • short-tailed shrews (Blarina_brevicauda)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Sorex cinereus is prey of:
Squamata
Strigiformes
Accipitridae
Falconidae
Mustela
Blarina brevicauda
Felis silvestris
Vulpes vulpes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Sorex cinereus preys on:
non-insect arthropods

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Large annual fluctuations in population size. Density estimates range from 1-12 shrews per acre (Buckner 1966). Home range about 0.10 acre. Usually in scattered, locally abundant populations. Rarely lives past second summer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Little is known of communication in masked shrews. They have an excellent sense of smell and can see fairly well. They use their sensitive whiskers to find their way around and detect prey. Masked shrews also probably squeak and hiss as a way of communicating.

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Little is known of communication in masked shrews. They have an excellent sense of smell and can see fairly well. They use their sensitive whiskers to find their way around and detect prey. Masked shrews also probably squeak and hiss as a way of communicating.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active throughout the day (and the year) to secure enough food to maintain high metabolic rate. Peak active period 0100-0200 (van Zyll de Jong 1983). Cloudy, rainy nights increase nocturnal activity.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Masked shrews probably do not live much past 1 to 2 years old, most probably die before reaching adulthood.

Typical lifespan

Status: wild:
2.0 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Masked shrews probably do not live much past 1 to 2 years old, most probably die before reaching adulthood.

Typical lifespan

Status: wild:
2.0 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals but they have been estimated to live up to 1.8 years (Ernest 2003).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The breeding season for Sorex cinereus occurs from April to October in eastern North America but may extend into November if food is plentiful. Length of gestation is unknown. The average number of embryo produced by various populations ranges from five to eight across North America, with at least two litters produced by a female in a breeding season. Both males and females may breed in their first summer but this is not typical (Nagorsen, 1996).

Breeding season: Masked shrews breed from April to November.

Range number of offspring: 4.0 to 10.0.

Average weaning age: 20.0 days.

Range age at sexual or reproductive maturity (female): 5.0 to 11.0 months.

Range age at sexual or reproductive maturity (male): 5.0 to 11.0 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 0.28 g.

Average gestation period: 19 days.

Average number of offspring: 6.22.

Young are cared for and nursed by their mother in her nest until they reach about 20 days old.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding season may last from March through September (there is evidence of mid-winter births in at least some years in Nova Scotia) (Stewart et al. 1989). Usually 2 litters, may be 3. Gestation lasts 18 days. Litter size is 2-10 (average around 7). Young are weaned in 3 weeks. Sexually mature in 20-26 weeks. Some young may breed in the year of their birth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The breeding season occurs from April to October in eastern North America but may extend into November if food is plentiful. Length of pregnancy is unknown. Females have between 4 and 10 young per litter, and have at least two litters per breeding season. Both males and females may breed in their first summer, but this is not typical.

Breeding season: Masked shrews breed from April to November.

Range number of offspring: 4.0 to 10.0.

Average weaning age: 20.0 days.

Range age at sexual or reproductive maturity (female): 5.0 to 11.0 months.

Range age at sexual or reproductive maturity (male): 5.0 to 11.0 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 0.28 g.

Average gestation period: 19 days.

Average number of offspring: 6.22.

Young are cared for and nursed by their mother in her nest until they reach about 20 days old.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sorex cinereus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 584 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATATAGTATTTGGTGCTTGAGCCGGTATAGTAGGCACAGCCCTAAGCATTCTAATTCGTGCTGAATTAGGCCAACCAGGCGCACTACTAGGTGATGACCAAATCTATAATGTAATCGTTACTGCTCACGCATTTGTTATAATTTTCTTTATAGTTATGCCTATCATACTTGGAGGTTTTGGAAATTGACTTATTCCTCTAATGATTGGTGCCCCCGATATAGCTTTCCCACGTATAAACAATATAAGCTTTTGACTACTTCCTCCCTCATTCCTATTACTTCTAGCTTCATCAACCGTAGAAGCAGGAGCAGGAACAGGCTGAACCGTTTATCCCCCACTAGCCGGTAACTTAGCCCACGCAGGAGCATCCGTTGACCTAGCAATTTTTTCCCTACACCTAGCAGGTGTCTCATCAATCTTAGGCTCAATTAATTTTATTACTACTATTATTAACATAAAACCTCCCGCAATATCTCAATATCAAACACCATTATTTGTATGATCTGTCTTAATTACAGCAGTATTGCTACTCCTTTCACTTCCAGTACTTGCAGCTGGAATTACAATATTATTAACAGATCGTAATCTTAACACTACATTCTTTGATCCCGCTGGAGGTGGAGACCCTATTCTTTATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sorex cinereus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 598
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Common shrews are common and widespread and none of the Genus Sorex, including Sorex cinereus, are considered to be threatened or endangered species (Boyd et al., 1999; Nagorsen, 1996; Wilson and Ruff, 1999).

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
NatureServe

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern because it is a widespread and abundant species with no major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Masked shrews are common and widespread.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is widespread and abundant.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: This and other generalist insectivores are not likely to be impacted negatively by selective insecticides such as BACILLUS THURINGIENSIS (Bellocq et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Negative impacts of S. cinereus are unknown. However, they may affect populations of some beneficial organisms or inhibit reproduction of some plants by consuming seeds (Nagorsen, 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The extent to which common shrew populations affect humans is unknown. However, they have a significant impact on populations of insect pests and are important members of communities (Nagorsen, 1996).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

The negative impacts of masked shrews are unknown. They may affect populations of some beneficial organisms or inhibit reproduction of some plants by consuming seeds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

The extent to which masked shrew populations affect humans is unknown. However, they have a significant impact on populations of insect pests and are important members of communities.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cinereus shrew

The cinereus shrew or masked shrew (Sorex cinereus) is a small shrew found in Alaska, Canada and the northern United States.[2] This is the most widely distributed shrew in North America, where it is also known as the common shrew.

Description[edit]

It is grey-brown in colour with a light grey underside and a pointed snout. It has a long tail which is brown on top and pale underneath with a dark tip. Its body is about 9 cm in length including a 4 cm long tail. It weighs about 5 g. It has darker coloring than other shrews. Masked shrews can live up to two years, but averagely only survive eighteen months.

Yom-Tov et al. (2005) found that the masked shrew body size opposes Bergmann’s rule, decreasing with latitude and increasing with January temperatures in Alaska. Also, Yom-Tov et al. (2005) showed that body and tail length increased with rising temperatures during the second half of the twentieth century. This may be due to higher temperatures increasing the availability of the shrews’ diets.

Distribution[edit]

The masked shrew is the most widely distributed shrew (Merritt 1995). Its range covers most of northern North America extending south as far down to Maryland, along the Rocky Mountains in the west, and to the Appalachians in the east. This species was introduced into Newfoundland in the late 1950s. It can be found in many types of habitat like arid grasslands, moist areas, woodland and tundra. The masked shrew mostly lives in humid areas and with high levels of vegetation to hide in. Moisture determines the abundance of this shrew.

Predation and Parasitism[edit]

Predators include larger shrews, hawks, owls, shrikes, snakes, herons, and foxes, leopard frog, bluebird, brown trout, and weasels. Masked shrews are susceptible to many types of parasites, like fleas and tapeworms (Cowan 2007). Cowan et al. (2007) found that the high volume of food masked shrews consume causes them to be more susceptible to parasitism. Since males have larger ranges they have a higher exposure to parasites (Cowan 2007).

Diet and Prey[edit]

Masked shrews are opportunistic generalists. They eat insects, worms, snails, small rodents, salamanders, and seeds. Due to its high metabolism, the masked shrew can eat three times its weight a day (Whitaker 2004). The shrews have to eat almost constantly because they can only survive a few hours without food (Whitaker 2004). Their metabolism drops when they are at rest.

McCay et al. (1997) found a higher abundance of masked shrews in non-irrigated forests due to a higher availability of larval insects, which was the preferred food source of the masked shrew. Masked shrews chose Lepidoptera larva over other food sources (McCay 1997).

Behavior[edit]

This animal is active day and night year-round. Masked shrews can be nocturnal or diurnal depending on the weather. Doucet et al. (1974) showed that rain increases the nocturnal activity of the masked shrew, while cloud cover increases day and night activity. It digs tunnels but also uses tunnels created by other small mammals. It uses dry grass to make nests in these tunnels. It can make high frequency pulses and has lateral scent glands. The home range of the masked shrew depends on availability of food, but is averagely 0.55 hectare. It has a low tolerance for other shrews in its home range. Merritt et al. (1995) found that its mass declined by half from summer to winter and non-shivering heat production, energy conservation, and reduced body mass.

Reproduction[edit]

Masked shrews living at high latitudes are born in late spring and summer, reach adult size by the time they leave their nests and complete their life cycle within a year (Yom-Tov 2005). They are born during spring or summer, remain immature in winter, and breed the following spring (Merritt 1995). Masked shrews breed from May to September. Females have one litter of 6-7 young during the breeding season. The young are born hairless, clawless, and have translucent abdominal walls (Whitaker 2004). Body mass increases and peaks at twenty days, then decreases when the young leave the nest after about 27 days. Masked shrews have a high chance of mortality during their first two months of life and most die during the first year. Masked shrews become sexually mature at two months, but wait until their first spring to breed.

References[edit]

  1. ^ Hutterer, R. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 286. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b NatureServe (2008). "Sorex cinereus". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 8 February 2010. 

Cowan, K. M., Shutler, D., Herman, T. B., & Stewart, D. T. (2007). EXTREME MALE-BIASED INFECTIONS OF MASKED SHREWS BY BLADDER NEMATODES. Journal Of Mammalogy, 88(6), 1539-1543.

Doucet, G.J & Bider, J.R. (1974). The effects of weather on the activity of the masked shrew. Journal of Mammalogy, 55(2), 348-363. http://www.jstor.org/stable/1379003

Hutterer, Rainer (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M.. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 286. ISBN 978-0-8018-8221-0. OCLC 62265494.

Lee, W. 2001. "Sorex cinereus" (On-line), Animal Diversity Web. Accessed November 26, 2011 http://animaldiversity.ummz.umich.edu/site/accounts/information/Sorex_cinereus.html.

McCay, T. S., & Storm, G. L. (1997). Masked shrew (Sorex cinereus) abundance, diet and prey. American Midland Naturalist, 138(2), 268.

Merritt, J.F. (1995). Seasonal thermogenesis and changes in body mass of masked shrews, Sorex cinereus. Journal of Mammalogy, 76(4), 1020-1035. http://www.jstor.org/stable/1382596

NatureServe (2008). "Sorex cinereus". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 8 February 2010.

Whitaker, John O. (2004). Sorex cinereus. Mammalian Species No. 743 (pp. 1–9). American Society of Mammologists http://www.science.smith.edu/msi/pdf/743_Sorex_cinereus.pdf

Yom-Tov, Y., & Yom-Tov, J. (2005). Global warming, Bergmann's rule and body size in the masked shrew Sorex cinereus Kerr in Alaska.Journal Of Animal Ecology, 74(5), 803-808. doi:10.1111/j.1365-2656.2005.00976.x

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Several formerly recognized subspecies recently have been regarded as distinct species (e.g., see van Zyll de Jong 1983). A population in western Washington and adjacent British Columbia was recognized as a distinct species (S. rohweri) by Rausch et al. (2007).

According to George (1988), electrophoretic data contradict morphometric evidence that S. fontinalis is conspecific with S. cinereus. However, results of a recent analysis of cranial morphology do not support the view that fontinalis is specifically distinct from S. cinereus; electrophoretic support for separation of the two as distinct species is based on a small sample size from one small geographic area (van Zyll de Jong 1989). Van Zyll de Jong (1999) and Demboski and Cook (2003) concluded that S. fontinalis should be regraded as a subspecies of S. cinereus, but the North American mammal checklist by Baker et al. (2003) kept S. fontinalis as a species, based on electrophoretic results of George (1988).

The same study (George 1988) supports separation of S. haydeni and S. cinereus as independent species. Despite distinct morphological and karyotypic (Volobouev and van Zyll de Jong 1994) differences between S. haydeni and S. cinereus, in Alberta these taxa were less genetically differentiated than were conspecific populations of S. cinereus across Canada; there were no fixed allele differences among the populations sampled, but there was a unique allele at a moderate frequency in S. haydeni; this may be indicative of no gene flow between these two taxa, and thus they may be valid species; evidently S. cinereus is a paraphyletic taxon (Stewart et al. 1993).

Based on evidence of bidirectional mtDNA introgression in Minnesota, Brunet et al. (2002) concluded that S. haydeni does not warrant specific status, but Demboski and Cook (2003) found that S. cinereus and S. haydeni do not appear to be sister species and regarded S. haydeni as a valid species (based on a mtDNA phylogeny). The North American mammal checklist by Baker et al. (2003) maintained S. haydeni as a distinct species.

MtDNA data are not concordant with currently accepted subspecific designations in S. cinereus (Stewart and Baker 1997).

Sorex milleri of Mexico apparently represents a relict population of S. cinereus and may not have attained specific status (van Zyll de Jong 1989).

See Stewart and Baker (1992) for information on genetic differentiation and biogeography of island and mainland populations in southeastern Canada, where certain island populations have diverged genetically to a level that may be indicative of incipient speciation or subspeciation.

Rausch and Rausch (1995) examined karyotypic and morphological characteristics of shrews on St. Lawrence Island and the Alaskan mainland and found no significant differences; they concluded that S. jacksoni should be regarded as a subspecies of S. cinereus. However, van Zyll de Jong (in Wilson and Ruff 1999) and Demboski and Cook (2003) continued to recognize S. jacksoni as a species. Based on the data of Demboski and Cook (2003), the North American mammal checklist by Baker et al. (2003) recognized S. jacksoni as a valid species.

Demboski and Cook (2003) used DNA sequence data to examine phylogenetic relationships among 8 members of the Sorex cinereus group (S. camtschatica, S. cinereus, S. haydeni, S. jacksoni, S. portenkoi, S. preblei, S. pribilofensis, and S. ugyunak) and S. longirostris. Phylogenetic analyses recovered 2 major clades within the species group: a northern clade that includes the Beringian species (S. camtschatica, S. jacksoni, S. portenkoi, S. pribilofensis, and S. ugyunak), S. haydeni

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!