Opistognathus rosenblatti — Details

Blue-spotted Jawfish learn more about names for this taxon

EOL is scheduled for maintenance on Thursday, June 20 between 8:00 and 10:00 AM EDT.
During this time you may find changes in EOL's performance and availability.

Overview

Brief Summary

WhyReef - Lifestyle

The life of the bluespotted jawfish revolves around its precious burrow. At night it covers the entrance, and every morning rebuilds it. It lines the burrow with pebbles and shells to make sure it is extra-strong. Sometimes, it will even steal parts of other jawfishes’ burrows to improve its own! It spends its days around its burrow because it provides excellent protection from predators.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Found in large colonies. Feeds on benthic and planktonic invertebrates. Covers its burrow entrance at dusk and rebuilds the opening each morning.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: jawfish (English), bocón (Espanol)
 
Opistognathus rosenblatti Allen & Robertson, 1991


Blue-spotted jawfish



Elongate, compressed, tapering body; large bulbous head; eye large, high; no cirrus at front nostril; end of top jaw straight, without fringe at rear; upper jaw 51-53% of head length, same size in males and females; lips with inner papillae; center of roof of mouth without teeth; no broad flap under operculum; gill rakers 34-35; dorsal rays XI, 13-14; anal rays II, 13-14; pectoral rays 18 (rarely 17); tail rounded, much shorter than head; lateral line on front half of body only, high; scales small, smooth, none on head, body with 65-70 oblique scale rows.



Females and non-courting males  with orange-brown head and dark brown to blackish body, covered with relatively large blue spots; courting males white anteriorly and blackish on posterior half with large brown spot on anterior part of dorsal fin; no obvious color inside mouth; small juveniles yellow with blue spots.


Maximum size about 10 cm.

Habitat: found in sandy rubble areas in colonies of up to several hundred fish with a minimal spacing of about 1m between individuals; each fish constructs a lid over their burrow entrance at dusk and rebuilds the opening each morning.

Depth: 5-25 m.

The  lower 3/4 of the Gulf of California and the Revillagigedo Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The bluespotted jawfish is well-named, because its mouth is an all-purpose tool. Very, very large compared to the rest of its body, its mouth is of course used for eating, but also to scoop up sand, coral rubble, and broken shells to make a hole, or burrow, to live in. The bluespotted jawfish also uses its mouth to raise its kids: the males hold the eggs in their mouth until they hatch.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Central Pacific: Gulf of California.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Bluespotted Jawfish (Opistognathus rosenblatti) is endemic to the eastern Pacific and this is found at the tip of Baja California and the lower three-quarters of the Gulf of California, Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 5 (S) - 25 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 10.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 100 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 11482))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Opistognathus rosenblatti Allen & Robertson
Catalog Number: USNM 316792
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): G. Allen & D. Robertson
Year Collected: 1990
Locality: Isla San Pedro Martir, Gulf of California, Mexico., Mexico, Gulf of California, Pacific
Depth (m): 12 to 12
  • Holotype: Allen, G. R. & Robertson, D. R. 1991. Revue Francaise d'Aquariologie, Herpetologie. 18 (2): 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Opistognathus rosenblatti Allen & Robertson
Catalog Number: USNM 316791
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): G. Allen & D. Robertson
Year Collected: 1990
Locality: Isla San Pedro Martir, Gulf of California, Mexico., Mexico, Gulf of California, Pacific
Depth (m): 12 to 12
  • Paratype: Allen, G. R. & Robertson, D. R. 1991. Revue Francaise d'Aquariologie, Herpetologie. 18 (2): 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 12 - 12 m (Ref. 58018)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Bluespotted Jawfish is a demersal species, found in sandy rubble areas at depths of 5–25 m. It can form colonies of up to several hundred fish.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 6 - 12
  Temperature range (°C): 22.443 - 23.459
  Nitrate (umol/L): 0.739 - 3.645
  Salinity (PPS): 35.036 - 35.261
  Oxygen (ml/l): 4.879 - 4.970
  Phosphate (umol/l): 0.656 - 0.897
  Silicate (umol/l): 4.734 - 7.763

Graphical representation

Depth range (m): 6 - 12

Temperature range (°C): 22.443 - 23.459

Nitrate (umol/L): 0.739 - 3.645

Salinity (PPS): 35.036 - 35.261

Oxygen (ml/l): 4.879 - 4.970

Phosphate (umol/l): 0.656 - 0.897

Silicate (umol/l): 4.734 - 7.763
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on benthic and planktonic invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Planktivore

Diet: zooplankton, pelagic fish eggs, pelagic fish larvae, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

WhyReef - Menu

Finding food is easy for the bluespotted jawfish: it just opens its mouth. It eats tiny animals called zooplankton that float in the sea. Because it only eats other animals, it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Brooded, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Opistognathus rosenblatti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACTGCCCTCAGCCTTCTCATCCGAGCAGAACTTAGCCAACCTGGCGCGCTTCTTGGCGACGACCAGATCTACAATGTAATTGTTACAGCACACGCCTTTGTAATAATTTTCTTCATGGTAATACCAATTATGATTGGAGGTTTTGGTAACTGGCTAATCCCTCTAATGATCGGAGCCCCTGACATAGCATTCCCTCGAATAAACAATATGAGTTTTTGACTCCTACCCCCATCCTTCCTCCTACTCCTAGCTTCCTCCGGAGTGGAGGCTGGTGCCGGTACGGGTTGAACCGTTTACCCACCTCTCTCAGGAAACCTGGCCCACGCCGGAGCCTCTGTTGATTTAACTATCTTTTCTCTCCACCTAGCAGGTGTGTCCTCAATTCTCGGGGCTATTAACTTCATTACAACAATTATTAATATAAAACCCCCTGCTATTTCCCAGTACCAAACACCCCTGTTTGTATGGGCTGTCTTAATTACTGCCGTCCTGCTCCTCCTTTCCCTCCCTGTCCTTGCAGCAGGTATTACAATACTACTCACAGATCGAAACTTAAACACCACTTTCTTTGACCCTGCGGGAGGAGGAGACCCAATTCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Opistognathus rosenblatti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
McCosker, J.E., Acero, A. & Espinosa, H.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
The Bluespotted Jawfish (Opistognathus rosenblatti) has been assessed as Least Concern. This species is endemic to Mexico and is considered abundant in many parts of its range. There are no known major threats to this species, and currently no indication of population decline from its collection for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Bluespotted Jawfish is locally abundant at several island locations in the Gulf of California and near Cabo San Lucas.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Although not considered a major threat at this time, the Bluespotted Jawfish is collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

Reefs are in danger, and that means so is the home of the bluespotted jawfish!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Bluespotted Jawfish may occur in a number of marine protected areas in the eastern tropical Pacific region (WDPA 2006), and it is protected by law in Mexico. Given its collection for the aquarium trade, population trends should be monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue-spotted jawfish


Opistognathus rosenblatti is a jawfish from the Eastern Central Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 10cm in length.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!