Overview
Comprehensive Description
Biology
Often seen in small schools on exposed reef flats and seaward reefs (Ref. 1602).
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Distribution
Pacific Ocean: Ryukyu Islands to the Line and Ducie islands, north to the Ryukyu Islands, south to the Great Barrier Reef.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Range Description
This species is found from the Ryukyu Islands in the north to the Great Barrier Reef in the south, to Micronesia, Line Islands, Tuamotu Archipealago and Pitcairn Islands in the east (G. Allen pers comm. 2009). It extends into marginal reef areas at the southern limits of its range: Middleton Reef, Rapa and Pitcairn. It was recorded from Nuie as the most abundant large parrotfish (R. Bonaldo pers comm. 2009) It has also been recorded from Halmahera, Indonesia (Green and Muljadi 2009).
Trusted
Physical Description
Morphology
Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Size
Max. size
50.0 cm TL (male/unsexed; (Ref. 2334))
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Diagnostic Description
Coloration changes slowly with growth. The light green patch on the caudal peduncle is present on individuals as small as 15 cm and the distinctive tan facial markings are on most individuals above 20 cm. Large males develop a near-vertical forehead profile and long lobes and a well-developed lunate caudal fin.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Type Information
Paratype for Chlorurus frontalis
Catalog Number: USNM 51834
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
Catalog Number: USNM 51834
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
- Paratype: Jordan, D. S. & Seale, A. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 329, pl. XLIX.
Trusted
Type for Chlorurus frontalis
Catalog Number: USNM 51755
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
Catalog Number: USNM 51755
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
- Type: Jordan, D. S. & Seale, A. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 329, pl. XLIX.
Trusted
Type for Chlorurus frontalis
Catalog Number: USNM 19221
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Streets
Year Collected: 1873
Locality: Palmyra Island, Palmyra Atoll, United States Minor Outlying Islands, Line Islands, Pacific
Catalog Number: USNM 19221
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Streets
Year Collected: 1873
Locality: Palmyra Island, Palmyra Atoll, United States Minor Outlying Islands, Line Islands, Pacific
- Type:
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range ? - 40 m (Ref. 9710)
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
This is a large excavating parrotfish (50 cm TL). It is characteristic of exposed reef crests and and seaward reefs to 40 m. It is usually seen in small schools.
Systems
- Marine
Trusted
Depth range based on 1 specimen in 1 taxon.
Environmental ranges
Depth range (m): 15 - 15
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Environmental ranges
Depth range (m): 15 - 15
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 0 - 40m.
Recorded at 40 meters.
Habitat: reef-associated.
Recorded at 40 meters.
Habitat: reef-associated.
Trusted
Trophic Strategy
Occurs inshore (Ref. 75154).
-
Bellwood, D.R. and J.H. Choat 1990 A functional analysis of grazing in parrotfishes (family Scaridae): the ecological implications. Environ. Biol. Fish. 28:189-214. (Ref. 26993)
http://www.fishbase.org/references/FBRefSummary.php?id=26993&speccode=4976
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Chlorurus frontalis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTCCTTATCCGAGCTGAATTAAGCCAACCCGGGGCCCTTCTCGGTGACGATCAGATTTATAATGTTATCGTTACAGCTCATGCATTCGTAATGATCTTTTTTATAGTCATGCCCATCATAATTGGAGGTTTTGGAAATTGACTTATCCCGCTTATGATCGGAGCACCCGACATGGCCTTCCCCCGAATAAATAACATAAGCTTCTGACTTCTCCCACCTTCTTTCCTCCTGCTACTTGCCTCCTCTGGCGTTGAAGCGGGAGCAGGGACCGGATGGACTGTTTACCCCCCACTGGCCGGGAATCTTGCACACGCAGGTGCATCTGTTGACCTAACAATTTTCTCCCTCCACCTGGCAGGAATCTCTTCAATCCTAGGGGCAATTAACTTCATCACAACTATCATCAACATGAAACCCCCTGCCATTTCCCAATACCAAACCCCCCTCTTCGTGTGAGCTGTTTTAATCACTGCCGTACTCCTTCTTCTCTCACTCCCTGTCCTTGCTGCAGGGATCACAATGCTACTAACAGATCGAAATCTAAATACTACCTTCTTCGATCCTGCAGGGGGAGGAGACCCCATTCTTTATCAGCACCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Chlorurus frontalis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2010
Assessor/s
Choat, J.H., Carpenter, K.E., Clements, K.D., Rocha, L.A., Russell, B., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P.
Reviewer/s
McIlwain, J. & Craig, M.T.
Contributor/s
Justification
This species is widespread and is found in remote locations. It is abundant at Niue and Middleton Reef. It is captured in artisanal and subsistence fisheries in parts of its range and is heavily exploited in some locations like Guam. However, harvesting is not considered to contribute to global population declines and it is found in a number of marine protected areas throughout its range. It is therefore listed as Least Concern.
Trusted
Trends
Population
Population
Population Trend
This species is relatively rare over most of its range but fairly common in Middleton Reef, estimates of 2-8 individuals per hectare (Choat et al. 2006). It is abundant at Nuie. It achieves its highest densities on reefs at the southern limit of its range.
Catch records from Guam reported a total of 14,990 kg of C. frontalis landed over the period 1985-2007. It is the 7th most exploited species in Guam. From 1985-1989, an annual average of 669 kg was landed and from 2003-2007, 241 kg landed. The total landed weight of parrotfish in 1985 was 11,532 kg and in 2007 was 4,805 kg. The fishery follows a trend of reduced proportion of larger species (R.F. Myers pers comm. 2009). Recent underwater visual survey (UVC) undertaken in 2008 at 28 sites around Guam reveal this species is only present inside marine reserves (J. McIlwain pers comm. 2010). It is particularly vulnerable to spearfishing because of its preference for shallow habitat.
Catch records from Guam reported a total of 14,990 kg of C. frontalis landed over the period 1985-2007. It is the 7th most exploited species in Guam. From 1985-1989, an annual average of 669 kg was landed and from 2003-2007, 241 kg landed. The total landed weight of parrotfish in 1985 was 11,532 kg and in 2007 was 4,805 kg. The fishery follows a trend of reduced proportion of larger species (R.F. Myers pers comm. 2009). Recent underwater visual survey (UVC) undertaken in 2008 at 28 sites around Guam reveal this species is only present inside marine reserves (J. McIlwain pers comm. 2010). It is particularly vulnerable to spearfishing because of its preference for shallow habitat.
Population Trend
Stable
Trusted
Threats
Least Concern (LC)
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Major Threats
This species is captured by artisanal and subsistence fisheries in parts of its range. It is heavily fished in Guam. However, localized declines through harvesting are not considered to be causing global population declines.
Trusted
Management
Conservation Actions
Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
aquarium: commercial
-
Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
http://www.fishbase.org/references/FBRefSummary.php?id=9210
Trusted


