Overview

Comprehensive Description

Biology

Often seen in small schools on exposed reef flats and seaward reefs (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Pacific Ocean: Ryukyu Islands to the Line and Ducie islands, north to the Ryukyu Islands, south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found from the Ryukyu Islands in the north to the Great Barrier Reef in the south, to Micronesia, Line Islands, Tuamotu Archipealago and Pitcairn Islands in the east (G. Allen pers comm. 2009). It extends into marginal reef areas at the southern limits of its range: Middleton Reef, Rapa and Pitcairn. It was recorded from Nuie as the most abundant large parrotfish (R. Bonaldo pers comm. 2009) It has also been recorded from Halmahera, Indonesia (Green and Muljadi 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Coloration changes slowly with growth. The light green patch on the caudal peduncle is present on individuals as small as 15 cm and the distinctive tan facial markings are on most individuals above 20 cm. Large males develop a near-vertical forehead profile and long lobes and a well-developed lunate caudal fin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Chlorurus frontalis
Catalog Number: USNM 51834
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Paratype: Jordan, D. S. & Seale, A. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 329, pl. XLIX.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Chlorurus frontalis
Catalog Number: USNM 51755
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Type: Jordan, D. S. & Seale, A. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 329, pl. XLIX.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Chlorurus frontalis
Catalog Number: USNM 19221
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Streets
Year Collected: 1873
Locality: Palmyra Island, Palmyra Atoll, United States Minor Outlying Islands, Line Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 40 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is a large excavating parrotfish (50 cm TL). It is characteristic of exposed reef crests and and seaward reefs to 40 m. It is usually seen in small schools.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 15 - 15
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 40m.
Recorded at 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chlorurus frontalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTCCTTATCCGAGCTGAATTAAGCCAACCCGGGGCCCTTCTCGGTGACGATCAGATTTATAATGTTATCGTTACAGCTCATGCATTCGTAATGATCTTTTTTATAGTCATGCCCATCATAATTGGAGGTTTTGGAAATTGACTTATCCCGCTTATGATCGGAGCACCCGACATGGCCTTCCCCCGAATAAATAACATAAGCTTCTGACTTCTCCCACCTTCTTTCCTCCTGCTACTTGCCTCCTCTGGCGTTGAAGCGGGAGCAGGGACCGGATGGACTGTTTACCCCCCACTGGCCGGGAATCTTGCACACGCAGGTGCATCTGTTGACCTAACAATTTTCTCCCTCCACCTGGCAGGAATCTCTTCAATCCTAGGGGCAATTAACTTCATCACAACTATCATCAACATGAAACCCCCTGCCATTTCCCAATACCAAACCCCCCTCTTCGTGTGAGCTGTTTTAATCACTGCCGTACTCCTTCTTCTCTCACTCCCTGTCCTTGCTGCAGGGATCACAATGCTACTAACAGATCGAAATCTAAATACTACCTTCTTCGATCCTGCAGGGGGAGGAGACCCCATTCTTTATCAGCACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chlorurus frontalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Choat, J.H., Carpenter, K.E., Clements, K.D., Rocha, L.A., Russell, B., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P.

Reviewer/s
McIlwain, J. & Craig, M.T.

Contributor/s

Justification
This species is widespread and is found in remote locations. It is abundant at Niue and Middleton Reef. It is captured in artisanal and subsistence fisheries in parts of its range and is heavily exploited in some locations like Guam. However, harvesting is not considered to contribute to global population declines and it is found in a number of marine protected areas throughout its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is relatively rare over most of its range but fairly common in Middleton Reef, estimates of 2-8 individuals per hectare (Choat et al. 2006). It is abundant at Nuie. It achieves its highest densities on reefs at the southern limit of its range.

Catch records from Guam reported a total of 14,990 kg of C. frontalis landed over the period 1985-2007. It is the 7th most exploited species in Guam. From 1985-1989, an annual average of 669 kg was landed and from 2003-2007, 241 kg landed. The total landed weight of parrotfish in 1985 was 11,532 kg and in 2007 was 4,805 kg. The fishery follows a trend of reduced proportion of larger species (R.F. Myers pers comm. 2009). Recent underwater visual survey (UVC) undertaken in 2008 at 28 sites around Guam reveal this species is only present inside marine reserves (J. McIlwain pers comm. 2010). It is particularly vulnerable to spearfishing because of its preference for shallow habitat.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is captured by artisanal and subsistence fisheries in parts of its range. It is heavily fished in Guam. However, localized declines through harvesting are not considered to be causing global population declines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!