Overview

Brief Summary

The mummichog, Fundulus heteroclitus, is a killifish in the family Fundulidae native to brackish and coastal waters along the Eastern North American seaboard from Florida to the Gulf of St. Lawrence. Known for its hardiness and tolerance of a wide range of salinity, oxygen levels, temperature and pollution in their environment, they also have a broad diet including diatoms, a range of invertebrates, fish and fish eggs and sea grass. Mummichogs have been used widely as an experimental fish since the end of the nineteenth century, in studies such as embryology, regeneration, developmental genetics, and starting in about 1930, in studies of endocrinology and toxicity. In addition, mummichogs have been included in biology experiments on space missions such as Spacelab 3 and Bion 3. In 1973 a pair of mummichogs were the first space fish on a voyage on Spacelab 3, investigating the role of otolith (earbone) organs. They are used to stock small ponds for mosquito control, and for bait.

(Atz 1986; Kraft, Carlson, and Carlson 2006; Webster’s online dictionary; Wikipedia 8 February 2012; Wikipedia 17 December 2011)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: Atlantic Coast from Gulf of St. Lawrence to ne. Florida. Subspecies MACROLEPIDOTUS: Newfoundland south to Connecticut, with disjunct populstions in upper Chesapeake and Delaware bays. Subspecies HETEROCLITUS: New Jersey south to Florida, including lower southern Chesapeake and Delaware bays. (Morin and Able 1983, Able and Felley 1986). These distributions are supported by morphological (Able and Felley 1986, Morin and Able 1983) and nuclear gene data (see Brown and Chapman 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Fundulus heteroclitus heteroclitus, a species of killifish commonly known as the mummichog, occurs along the Atlantic coast of North America. They extend from the Gulf of St. Lawrence all of the way to the gulf coast of Texas. The waters of Sable Island, southeast of Halifax, Canada, has also been known to be inhabited by Fundulus heteroclitus. These remarkable fish also live inland in tidal creeks and lagoons (Rutherford, 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of St. Lawrence to northeastern Florida
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of Maine, Gulf of St. Lawrence, North West Atlantic, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coast of North America,from the Gulf of St.Lawrence to Texas.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Huber, J. H., 1996; Martin, K. L. M. and C. R. Bridges, 1999; Robins, C. R. and G. C. Ray, 1986; Gibson, R. N., 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

As adults, Fundulus heteroclitus heteroclitus range between 12.7 and 17.8 centimeters in length, the females growing larger than the males. They have flattened heads and the mouth is turned upward, clearly an adaptation to feeding at the surface of the water. This attractive fish is dimorphic, meaning that males and females have different physical characteristics. The males are darker in color than the females and exhibit blue or orange markings during the breeding season (Save the Bay, date unknown). Males are dark olive green on the dorsal side and lighter yellow on the ventral side. They also display vertical stripes along their sides. Females are silverish yellow on the ventral side and that color gradually fades to a more distinct yellow on the dorsal side. They also lack the stripes that male Fundulus heteroclitus heteroclitus display. All Fundulus heteroclitus heteroclitus have a single soft dorsal fin and their pelvic fins are located close to the rear fin (National Oceanic and Atmospheric Administration Coastal Services Center, 2001).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 13 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 125 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 15.0 cm TL (male/unsexed).
  • Bigelow, H. B. and Schroeder, W. C.,1953; Huber, J. H., 1996; Martin, K. L. M. and C. R. Bridges, 1999; Robins, C. R. and G. C. Ray, 1986; Gibson, R. N., 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Tidal creeks are the habitat of choice for Fundulus heteroclitus heteroclitus. They are also found in saltwater marshes, estuaries, and in sheltered shores where tides flow over eelgrass. The common feature between all of these habitats is that there is submerged vegetation where the fish can spawn and feed (Rutherford, 1996).

Fundulus heteroclitus heteroclitus is a remarkable fish. It has proven to be one of the most hardy and adaptable fish known. Most fish cannot survive for any period of time in waters as warm as 34° C. However, the mummichog can survive in this temperature for up to 63 minutes before falling victim to heat shock. It can also withstand temperature fluctuations from 6° C to 35° C (Abraham, 1985).

The mummichog also has a great tolerance to changes in salinity. Some mummichogs, such as the ones inhabiting the Chesapeake Bay area, prefer to live in freshwater and rarely, if ever, find themselves in salt water. Other mummichogs live along the coast in bays filled with seawater. The fish's upper limit for salinity is 106 - 120.3 ppt, while the average salinity of sea water is 32-33 ppt. This demonstrates the huge range of salinities that the mummichog can survive in (Abraham, 1985).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Benthopelagic species, found in saltwater marshes and tidal creeks, occasionally enters fresh water.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Common in salt marsh flats, estuaries, and tidal creeks, especially where there is abundant submergent and emergent vegetation. Adults use intertidal zone only when it is flooded; young remain on marsh even at low tide, inhabiting shallow puddles (Kneib 1986). Occasionally enters freshwater streams and rivers (Lee et al. 1980). May burrow into bottom mud in winter. Spawns in fresh, brackish, or saltwater; generally in estuarine and salt marsh environments. Eggs are laid in various sites at levels reached only by high spring tides; usually in sand in New England populations and in Spartina alterniflora or empty Geukensia demissa shells in Middle Atlantic and southern populations (Taylor 1986). Eggs normally incubate in air (aerial incubation apparently is essential for survival), not submerged until next spring tide. Abrupt decreases in salinity (e.g. due to spring freshets) may decrease fertilization success and increase larval mortality in local populations (Able and Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benthopelagic; freshwater; brackish; marine. A resident intertidal species with homing behavior. Mainly found in saltwater marshes and in tidal creeks. May leave tidepools if aquatic conditions become inhospitable. Enters fresh water to limited extent. Breathes air when out of water.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Huber, J. H., 1996; Martin, K. L. M. and C. R. Bridges, 1999; Robins, C. R. and G. C. Ray, 1986; Gibson, R. N., 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May migrate to mouth of tidal channel for winter, return up same channel in spring (Abraham 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Mummichogs primarily feed at the surface of the water (Government of Newfoundland and Labrador, date unknown). This feeding occurs predominantly at high tide during the daytime. They are however somewhat opportunistic feeders and will feed at all levels of the aquatic zone as long as there is food available. Mummichogs feed on a large variety of organisms. Some of the things that they eat include phytoplankton, mollusks, crustaceans, insect larvae, eggs of their own species, and vegetation such as eel grass. These fish have also been known to eat other smaller fish (Rutherford, 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds at surface, mid-water, and off bottom mainly on various invertebrates, also algae and detritus. Feeds mainly at high tide during daylight, but also feeds opportunistically (Abraham 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Omnivorous; vegetable matter, foraminifera, shrimps and other small crustacea, small mollusks; small fish.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Huber, J. H., 1996; Martin, K. L. M. and C. R. Bridges, 1999; Robins, C. R. and G. C. Ray, 1986; Gibson, R. N., 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Fundulus heteroclitus (common mummichog) is prey of:
Anatidae
Anguilliformes
Homo sapiens
Laridae

Based on studies in:
USA: Rhode Island (Marine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Fundulus heteroclitus (common mummichog) preys on:
detritus
Nematoda
Ostracoda
Copepoda
Amphipoda
Decapoda

Based on studies in:
USA: Rhode Island (Marine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Summer density of individuals longer than 40 mm may range from 0.35-6.04/ sq m in certain estuaries. Individuals longer than 60 mm maintained summer range of 36-38 m along bank of tidal creek; some moved up to 375 m (Abraham 1985). Preyed on by many species of fishes and wading birds; blue crab is a major predator of adults in some salt marshes. Predation by adult mummichogs and xanthid crabs may contribute to the high mortality of larvae and juveniles (Kneib 1986). See Weisburg (1986) for a discussion of competition and coexistence among this and other Fundulus species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: May become inactive in winter (Abraham 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The breeding patterns of Fundulus heteroclitus heteroclitus have been studied intensely. Fundulus heteroclitus heteroclitus have the ability to spawn up to eight times in one season (Rutherford, 1996). During spawning season, males become increasingly aggressive and they begin to display bright colors on their rear fins and bright spotting along the sides of their bodies. The spawning season begins in the spring and lasts until fall. Spawning takes place when the tides are highest during the new or full moon. This is because the eggs develop out of the water. They are laid on almost any surface around the spawning site. Common places for mummichog eggs are in empty mussel shells, on aquatic plants, in pits dug and covered by the female, and even directly on the bottom. The eggs are laid in the shallow area during high tide so when the tide goes out, they will be exposed to the air in which they develop. After the following monthly high tide, they are submerged in water again and begin to hatch (National Oceanic and Atmospheric Administration Coastal Services Center, 2001). This process takes approximately 24 days to complete. Females can release up to 460 eggs at one time and when the eggs are released, they affix themselves to whatever object they first contact (Government of Newfoundland and Labrador, date unknown).

When hatched, the larva of Fundulus heteroclitus heteroclitus are approximately seven millimeters long. They remain in the intertidal zone for six to eight weeks after hatching. Here they live on the outskirts of the marsh during high tides and in shallow pools during low tides. Once the larva are about 15-20 mm in length, they begin to move and swim with the adults in schools. When tides are low, these juveniles no longer stay in the shallow pools but move to subtidal marsh creeks and deep intertidal pools. Full physical maturity is reached in about two years (Rutherford, 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns spring through summer or early fall. May spawn 8 or more times during season; peaks coincide with high spring tides. Eggs hatch only when eggs are inundated, usually on spring tides (in about 7-8 days). Usually sexually mature in 2nd year, some in 1st year (Abraham 1985).

On the Atlantic coast of Nova Scotia, hybrids of F. DIAPHANUS and F. HETEROCLITUS are unisexual diploid gynogens; sperm from males probably is required to stimulate embryogenesis (Dawley et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oviparous. Eggs are about 2mm in diameter, colorless or pale yellowish and are surrounded by firm capsules that sink and become sticky on contact with the water. Capsules mass together in clumps or stick fast to sand grains or other substrate. Incubation; 9 to 18 days. Upon hatching, larvae is 7 to 7.7 long, yolk is fully absorbed, and pectoral and caudal fins are fully formed.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Huber, J. H., 1996; Martin, K. L. M. and C. R. Bridges, 1999; Robins, C. R. and G. C. Ray, 1986; Gibson, R. N., 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Video of spawning in Provincetown Harbor

Spawning mummichogs (fundulus heteroclitus) observed in Provincetown harbor crossing the West End breakwater. It was about 1 hour past high tide and about 3 days after the full moon. The water was about a foot deep at the time. See http://www.youtube.com/watch?v=IxEVxdwDBWE

(Note, I'm new to EOL, I'm not sure how to upload media, feel free to edit this article.)
Creative Commons Attribution 3.0 (CC BY 3.0)

© NotThePainter

Supplier: NotThePainter

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fundulus heteroclitus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC6793-09|FJ445401|Fundulus heteroclitus| ACACGTTGATTTTTCTCAACTAACCACAAAGATATCGGTACCCTTTATTTAGTATTTGGTGCCTGAGCCGGTATAGTAGGTACAGCTCTT---AGCCTTCTTATTCGGGCGGAACTAAGCCAACCAGGCTCTCTCCTAGGGGAT---GACCAAATTTATAATGTAATCGTTACAGCACATGCATTTGTAATAATCTTTTTTATAGTTATGCCTATTATAATTGGTGGCTTTGGAAATTGACTAGTCCCTCTTATG---ATCGGTGCCCCAGACATAGCTTTTCCTCGAATAAATAATATAAGCTTCTGACTACTCCCACCCTCATTTTTACTTCTCTTAGCCTCTTCCGGCGTTGAAGCCGGGGCTGGTACAGGTTGAACAGTCTATCCTCCTCTAGCAGGTAATTTAGCTCATGCTGGGGCTTCTGTAGATTTA---ACTATTTTTTCCCTTCACTTAGCTGGTATTTCATCAATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATATAAAACCTCCAGCTATCTCCCAATACCAAACCCCCCTGTTCGTCTGAGCTGTCTTAATTACTGCTGTACTTCTTCTACTTTCCTTACCAGTTCTTGCTGCA---GGAATTACAATACTGTTAACTGACCGAAATTTAAATACTACATTTTTTGATCCGGCAGGTGGAGGAGATCCAATTCTATACCAACATTTATTCTGATTCTTTGGTCACCCAGAAGTTTATATTCTTATTTTACCAGGCTTTGGTATAATTTCACATATTGTAGCATACTATTCTGGTAAAAAA---GAACCGTTTGGATATATGGGTATAGTATGAGCAATAATAGCAATTGGTCTTCTCGGCTTTATTGTTTGAGCCCATCACATATTTACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Fundulus heteroclitus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Species: 17
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Not available.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This fish preys on mosquito larvae and is therefore occasionally used instead of harmful pesticides to control mosquito population. They are an extremely important food source for many larger fish, which are valuable commercially, and for wading birds and seabirds (National Oceanic and Atmospheric Administration Coastal Services Center, 2001). For some of these birds mummichogs compose up to 95% of their entire diet. One final economic value of the mummichog is its use as bait for recreational fishing (Abraham, 1985).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Suitable for use in sophisticated genetic analyses; has been used to study endocrine mechanisms in osmoregulation; has played a central role in embryology in U.S.; being used to address questions about the evolutionary significance of protein polymorphism (Powers 1989). Used extensively and increasingly as a bioassay organism in toxicological investigations and as an indicator of marine water quality (Eisler 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mummichog

The mummichog, Fundulus heteroclitus, is a killifish. These fish are also known as mummies, gudgeons, and mud minnows and are found in brackish and coastal waters along the eastern seaboard of the United States as well as the Atlantic coast of Canada. It is noted for its hardiness and for being a popular research subject in embryological, physiological, and toxicological studies. The mummichog can also withstand a wide variety of toxins. This is an extremely tolerant species that can survive at very low oxygen levels and in heavily polluted ecosystems. It can also withstand temperatures as warm as 34 °C (93 °F) and temperature fluctuations from 6 °C to 35 °C (43 °F to 95 °C)

There are two subspecies:

Contents

Biology

Mummichogs are typically found in muddy marshes, channels, and grass flats along coastal areas. They travel in schools that may contain hundreds of individuals. Indeed, the name mummichog is derived from a Native American term which means "going in crowds".

The mummichog spawns on new and full moons in the spring and summer. Its eggs are laid near the high tide mark in empty mollusk shells or on dead vegetation and can tolerate long-term exposure to air. Typically mummichogs reach sexual maturity during their second year and live for a total of three years. [1]

Because of the extreme hardiness of the species, it is sometimes the only species found in severely polluted and oxygen-deprived streams, such as the Elizabeth River in Virginia, and the Hackensack River and the Arthur Kill in New Jersey during the height of the water pollution problem in the United States.

Mummichogs are hosts to a parasitic fluke, Homalometron pallidum, which has a complex life cycle which also involves the aquatic snail, Hydrobia minuta.[2]

Interest to humans

  • Mummichog eggs are used in teaching embryology, because it is possible to see the eyes and the beating heart and follow the different stages of ontogenesis.
  • Mummichogs are a common fish species used in toxicology studies.
  • Mummichogs are used to stock otherwise fishless ponds that breed mosquitos, and within three days the ponds are normally mosquito free.
  • In 1973 the mummichog became the first fish in space when carried on Skylab 3 as part of the biological experiments package. Later space missions by the U.S., such as Bion 3, have also carried mummichog.
  • Mummichogs are often caught in seines and minnow traps to be sold as live bait for fishermen.

Gallery

Notes

  1. ^ Murdy, Birdsong, Musick: Fishes of Chesapeake Bay (Smithsonian Institution Press, 1997), 128
  2. ^ Stunkard, Horace W. (1964). "The morphology, life history and systematics of the digenetic trematode Homalometron pallidum Stafford 1904". The Biological Bulletin 126 (1): 163–173. http://www.biolbull.org/content/126/1/163.full.pdf. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: A number of subspecies have been described, but only two (HETEROCLITUS and MACROLEPIDOTUS) have been recognized in most recent studies. The genus Fundulus was removed from Atheriniformes:Cyprinodontidae and placed in Cyprinodontiformes:Fundulidae by Parenti (1981); pending confirmation based on other character suites, this change was not accepted in the 1991 AFS checklist (Robins et al. 1991). Studies of mitochondrial DNA of subspecies HETEROCLITUS and MACROLEPIDOTUS of the U.S. Atlantic coast indicate that these two taxa exhibit secondary intergradation in northern New Jersey, Long Island, and in Chesapeake and Delaware bays (Gonzalez-Villasenor and Powers 1990), Able and Felley 1986). See Brown and Chapman (1991) and Powers (1989) for additional genetic studies of these populations. See Wiley (1986) for a study of the evolutionary relationships of Fundulus topminnows based on morphological characters. See Cashner et al. (1992) for an allozyme-based phylogenetic analysis of the genus Fundulus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!