Overview

Distribution

Western North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwest Pacific: southern Japan and China south to Hong Kong and northern Taiwan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

23.1 cm SL (male/unsexed; (Ref. 42181))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

About one-fourth of eye projecting above dorsal profile of head; interorbital space hemispherical when viewed from front, and not deep, the maximum depth contained more than 3 times in orbit diameter; fourth or fifth dorsal spines usually longest (2.6-3.15 in head length); first dorsal spine 1.7-2.1 in second spine; snout length 2.8-3.05 in head length (Ref 42181).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 3 - 91 m (Ref. 26165)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 38.1 - 38.1
  Temperature range (°C): 24.622 - 24.622
  Nitrate (umol/L): 0.181 - 0.181
  Salinity (PPS): 34.630 - 34.630
  Oxygen (ml/l): 4.802 - 4.802
  Phosphate (umol/l): 0.092 - 0.092
  Silicate (umol/l): 2.410 - 2.410
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scorpaenopsis cirrosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTAGTATTCGGTGCCTGAGCTGGAATGGTTGGAACAGCCCTAAGCCTGCTTATTCGAGCAGAGCTAAGTCAACCCGGGGCCCTTCTGGGCGACGACCAAATCTACAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTTGGGAATTGACTAATTCCCCTAATAATTGGAGCCCCAGATATGGCATTTCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCACCCTCCTTCCTCCTCCTATTAGCCTCCTCAGGTGTTGAAGCCGGTGCTGGAACTGGTTGGACAGTCTATCCACCCCTAGCTGGCAACCTAGCCCACGCAGGAGCCTCAGTAGATTTAACAATCTTTTCGCTCCATTTAGCAGGGATTTCATCAATTCTTGGTGCAATTAATTTCATCACCACAATTATTAATATGAAACCCCCAGCAATTTCTCAGTATCAAACACCTCTATTCGTATGGGCCGTTTTAATTACTGCCGTTCTTCTTCTTCTATCCCTCCCTGTTCTCGCTGCAGGCATTACAATACTTTTAACCGACCGTAACCTAAACACCACTTTCTTCGACCCCGCAGGAGGGGGAGACCCCATCCTTTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Scorpaenopsis cirrosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!