Overview
Distribution
Northwest Pacific: southern Japan and China south to Hong Kong and northern Taiwan.
-
Randall, J.E and W.N. Eschmeyer 2001 Revision of the Indo-Pacific scorpionfish genus Scopaenopsis, with descriptions of eight new species. Indo-Pac. Fish. (34):79 p. (Ref. 42181)
http://www.fishbase.org/references/FBRefSummary.php?id=42181&speccode=12080
Trusted
Physical Description
Size
Max. size
23.1 cm SL (male/unsexed; (Ref. 42181))
-
Randall, J.E and W.N. Eschmeyer 2001 Revision of the Indo-Pacific scorpionfish genus Scopaenopsis, with descriptions of eight new species. Indo-Pac. Fish. (34):79 p. (Ref. 42181)
http://www.fishbase.org/references/FBRefSummary.php?id=42181&speccode=12080
Trusted
Diagnostic Description
About one-fourth of eye projecting above dorsal profile of head; interorbital space hemispherical when viewed from front, and not deep, the maximum depth contained more than 3 times in orbit diameter; fourth or fifth dorsal spines usually longest (2.6-3.15 in head length); first dorsal spine 1.7-2.1 in second spine; snout length 2.8-3.05 in head length (Ref 42181).
-
Randall, J.E and W.N. Eschmeyer 2001 Revision of the Indo-Pacific scorpionfish genus Scopaenopsis, with descriptions of eight new species. Indo-Pac. Fish. (34):79 p. (Ref. 42181)
http://www.fishbase.org/references/FBRefSummary.php?id=42181&speccode=12080
Trusted
Ecology
Habitat
Environment
demersal; marine; depth range 3 - 91 m (Ref. 26165)
-
Weitkamp, D.E. and R.D. Sullivan 2003 Gas bubble disease in resident fish of the lower clark fork river. Trans. Am. Fish. Soc. 132(5):865-876. (Ref. 26165)
http://www.fishbase.org/references/FBRefSummary.php?id=26165&speccode=616
Trusted
Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 38.1 - 38.1
Temperature range (°C): 24.622 - 24.622
Nitrate (umol/L): 0.181 - 0.181
Salinity (PPS): 34.630 - 34.630
Oxygen (ml/l): 4.802 - 4.802
Phosphate (umol/l): 0.092 - 0.092
Silicate (umol/l): 2.410 - 2.410
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 38.1 - 38.1
Temperature range (°C): 24.622 - 24.622
Nitrate (umol/L): 0.181 - 0.181
Salinity (PPS): 34.630 - 34.630
Oxygen (ml/l): 4.802 - 4.802
Phosphate (umol/l): 0.092 - 0.092
Silicate (umol/l): 2.410 - 2.410
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Scorpaenopsis cirrosa
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTGTATCTAGTATTCGGTGCCTGAGCTGGAATGGTTGGAACAGCCCTAAGCCTGCTTATTCGAGCAGAGCTAAGTCAACCCGGGGCCCTTCTGGGCGACGACCAAATCTACAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTTGGGAATTGACTAATTCCCCTAATAATTGGAGCCCCAGATATGGCATTTCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCACCCTCCTTCCTCCTCCTATTAGCCTCCTCAGGTGTTGAAGCCGGTGCTGGAACTGGTTGGACAGTCTATCCACCCCTAGCTGGCAACCTAGCCCACGCAGGAGCCTCAGTAGATTTAACAATCTTTTCGCTCCATTTAGCAGGGATTTCATCAATTCTTGGTGCAATTAATTTCATCACCACAATTATTAATATGAAACCCCCAGCAATTTCTCAGTATCAAACACCTCTATTCGTATGGGCCGTTTTAATTACTGCCGTTCTTCTTCTTCTATCCCTCCCTGTTCTCGCTGCAGGCATTACAATACTTTTAACCGACCGTAACCTAAACACCACTTTCTTCGACCCCGCAGGAGGGGGAGACCCCATCCTTTATCAACACCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Scorpaenopsis cirrosa
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


