Overview

Comprehensive Description

Biology

Inhabits protected seagrass beds (Ref. 33839) and rock reef (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in sub-tropical to warm temperate waters of the south-eastern Indian Ocean, occurring only in south-western Western Australia from approximately North West Cape in the north and west, to Bremmer Bay in the south and east.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Indian Ocean: Western Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Australia: Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 14; Analspines: 3; Analsoft rays: 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

15.0 cm TL (male/unsexed; (Ref. 33839))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found mainly in shallow protected seagrass (Gomon et al. 2008) and algal habitats. It is also found in clear waters around coastal reef margins (Kuiter 2002). Small juveniles are secretive and solitary in protected reefs, larger juveniles and adults forming small to moderately large groups, especially over seagrass beds (Kuiter 2002).

This species probably feeds on small benthic invertebrates. It displays some sexual colour dimorphism, but it is not known if it is a protogynous hermaphrodite.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range ? - 30 m (Ref. 33839)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halichoeres brownfieldi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTCGGAGCCTGAGCCGGAATAGTGGGCACAGCCTTGAGCTTGCTTATTCGAGCCGAATTAAGCCAGCCCGGCGCTCTCCTCGGAGAC---GATCAGATTTACAATGTAATCGTTACAGCCCACGCCTTTGTGATAATCTTCTTTATAGTAATACCAATTATGATTGGCGGTTTCGGAAACTGACTGATTCCCTTAATGATTGGGGCCCCTGATATAGCCTTCCCCCGTATAAACAACATAAGCTTTTGACTCCTCCCCCCTTCCTTCCTTCTTCTACTTGCATCATCAGGAGTTGAAGCAGGTGCCGGAACTGGTTGAACTGTGTACCCCCCTCTAGCAGGAAACCTCGCCCATGCCGGAGCCTCCGTGGACTTAACCATTTTCTCCCTGCATCTAGCGGGGATTTCATCAATTCTAGGTGCAATTAATTTTATTACAACTATTATTAATATGAAACCCCCCGCTATCTCACAGTACCAGACGCCTCTTTTCGTGTGAGCTGTGTTAATCACTGCTGTACTGCTCCTCCTTTCCCTCCCCGTCCTAGCTGCCGGCATTACTATGCTGCTAACGGATCGAAATCTTAATACCACCTTCTTTGACCCCGCAGGAGGAGGAGACCCAATCCTTTATCAACACCTATTCTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Halichoeres brownfieldi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pollard, D., Choat, H. & Russell, B.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
Although the seagrass habitats of this species have in the past been degraded in parts of its range, this species is apparently fairly common and is protected in Marine Protected Areas within parts of its distribution. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no specific population information, though this species is claimed to be common and relatively abundant in seagrass and algal habitats in south-western Australia (Gomon et al. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this species. However, there are human impacts on seagrass habitats within its distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures, though the species is present in marine protected areas within parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!