Overview

Distribution

Range Description

Iceland, Scandinavia, northern Russia [absent in rivers draining to Baltic and White Seas] present in rivers of Barents Sea basin from Volonga to Kara, Jan Mayen, Spitzberg, Kolguev, Bear and New Zemblia islands, northern Siberia, Alaska, Canada and Greenland; 'real' S. alpinus might be restricted to Europe and Greenland. Despite its scientific name, does not occur in the Alps.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Circumpolar; in North America, Newfoundland to Alaska, south to southern Alaska and Maine/New Hampshire. Seldom more than 300 km from ocean. Has the most northern range of any North American freshwater fish (Page and Burr 1991). Locally abundant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic Ocean basin: North America and northern Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 96 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 960 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat:
Mainly lacustrine. Estuaries, rivers and lakes with cold, clear water. At sea, along coasts. Usually spawns on pebble to stone bottom in lakes. Riverine stocks spawn in rivers with slow current (0.2-0.8 m/s). Some riverine anadromous stocks in Norway spawn every year in fast-flowing waters of riffles.

Biology:
In large lakes, sympatric with S. lepechini. Most stocks differ in details of mode of life, migration, growth, reproduction, food. The following information apply to the species as a whole but do not apply exactly to a particular stock, which normally would have much less variable characteristics. Stocks north of about 65°N are anadromous. Juveniles spend their first 1-9 years in freshwater then move to the sea where they spend the short Arctic summer, returning to overwinter in frozen lakes. Some authors report that there is apparently no strict homing and that marine-feeding individuals become more opportunistic with age as to the choice of the river and lake they return to; in other areas, they consider that there is a strict homing. At sea, they remain in coastal areas; the longest documented marine migration is 940 km. Landlocked populations migrate within river drainage or are sedentary, lacustrine. Dwarf stocks are known in some Finnish lakes and upper stretches of rivers, characterised by a very slow growth rate; mature adults reach only 300-350 mm SL and 250-300 g (2000-5000 g in partly sympatric 'normal' lacustrine stocks). Lives up to a maximum of 32 years (usually up to 15). Anadromous stocks spawn for the first time at 4-10 years, lacustrine ones at 2-5; all individuals spawn every 3-4 years. Anadromous stocks grow much faster than lacustrine and riverine ones. Usually spawns in October-December; some populations spawn in spring, summer or winter. Prefers pebbles where males build nests 2-3 m in diameter. Usually, males are territorial and may spawn with several females. After spawning, some stocks return to sea, others remain 1-3 years in lake before returning to sea. In freshwater, feeds on benthos, plankton and small fish. At sea, feeds mainly on fish; anadromous individuals feed little in freshwater and not at all during migrations.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Coastal; usually not far inland except in large rivers (isolated in some lakes). Deep runs and pools of medium to large rivers and lakes. Some populations are anadromous; the young spend up to several years in the river, go to sea for summer, then return to the river each year for fall-spring. Spawning occurs in quiet pools in rivers or over gravel or rocky shoals in lakes. Eggs are buried in a nest on the bottom, from which the young emerge in summer a few months after hatching (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 6 - 120

Graphical representation

Depth range (m): 6 - 120
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 30 - 70m.
From 30 to 70 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Some populations are anadromous, and some of these are sympatric with resident freshwater populations. No evidence of extensive marine migrations in Fraser River, Labrador, population; upstream migration begins mid-July, extends to late September (Dempson and Green 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Varied diet of amphipods, mysids, fishes, and other small animals; opportunistic feeder (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Salvelinus alpinus (fishes (Salmo trutta, Salvelinus alpinus)) preys on:
zooplankton
Insecta
zoobenthos
Cyclops

Based on studies in:
Arctic (Marine)
Austria, Vorderer Finstertaler Lake (Lake or pond)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
  • R. Pechlaner, G. Bretschko, P. Gollmann, H. Pfeifer, M. Tilzer and H. P. Weissenbach, Ein Hochgebirgssee (Vorderer Finstertaler See, K htai, Tirol) als Modell des Energietransportes durch ein limnisches Oekosystem, Verh. Dtsch. Zool. Ges. 65:47-56, from p
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 40 years Observations: Mortality rate increases with age have been reported for wild populations (Patnaik et al. 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns in fall (peaks last 2 weeks of October in Labrador). Eggs hatch in spring. In Labrador, most females are sexually mature by 8 years, a few at 3 years (spawning migrants are 3-18 years old) (Dempson and Green 1985). Individuals spawn at 2-3-year intervals in north, yearly in south.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Salvelinus alpinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGATGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACCGCCCTTAGCCTCTTGATCCGGGCAGAGTTAAGCCAACCCGGAGCTCTTCTAGGGGATGACCAGATCTATAACGTAATCGTAACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTCATACCAATTATGATCGGGGGCTTTGGAAACTGATTAATCCCTCTAATAATTGGGGCCCCAGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTCCCACCGTCCTTTCTCCTTCTCCTGGCTTCGTCAGGGGTTGAAGCTGGCGCCGGTACGGGATGGACAGTCTACCCCCCTTTAGCCGGGAACCTCGCCCACGCAGGGGCCTCCGTTGATTTAACTATCTTCTCCCTTCATTTAGCTGGCATTTCCTCAATTTTAGGGGCCATTAACTTTATCACAACCATTATTAACATGAAGCCCCCAGCTATTTCTCAATATCAAACCCCGCTTTTTGTTTGAGCTGTGTTAGTTACTGCTGTCCTTTTATTACTTTCCCTCCCCGTTCTAGCAGCAGGCATTACTATGTTACTCACGGACCGAAATCTAAACACCACTTTCTTTGACCCGGCAGGCGGAGGGGACCCAATTTTATACCAACACCTCTTTTGATTCTTTGGTCACCCGGAGGTCTATATTCTTATTCTCCCAGGCTTTGGTATGATTTCCCACATCGTTGCATACTATTCCGGTAAAAAAGAACCCTTCGGGTATATAGGAATAGTCTGAGCTATAATAGCCATCGGACTCCTAGGATTCATCGTTTGGGCCCACCATATGTTTACTGTCGGAATAGATGTAGACACTCGTGCCTACTTTACATCTGCCACCATAATCATCGCCATCCCCACCGGAGTAAAAGTATTTAGCTGACTAGCCACACTACACGGCGGCTCAATTAAATGAGAAACACCGCTTCTTTGAGCCCTGGGGTTTATTTTCCTATTTACGGTCGGGGGACTCACGGGCATTGTCCTTGCTAATTCCTCATTAGACATTGTTCTCCACGACACTTATTATGTGGTCGCCCACTTTCACTATGTATTATCTATAGGAGCTGTCTTTGCCATTATAGGTGCTTTCGTACACTGATTCCCACTATTTACGGGATATACCCTCCACAGCACATGAACTAAAATCCACTTTGGAATTATATTTATCGGTGTAAATTTAACCTTTTTCCCGCAGCATTTCCTAGGCCTCGCAGGAATGCCCCGACGGTACTCTGACTATCCGGACGCCTACACACTATGAAACACTGTGTCCTCAATTGGGTCTCTTATCTCCTTAGTAGCTGTAATTATATTCCTATTTATTCTTTGAGAGGCTTTTGCCGCCAAACGAGAAGTAGCGTCAATCGAAATAACTTCAACAAACGTAGAGTGACTGCATGGATGTCCCCCACCCTACCACACATTTGAAGAGCCCGCATTTGTTCAAGTACAAGCAAACTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Salvelinus alpinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 5 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Contributor/s

Justification
A widespread species with no known major widespread threats. However, several populations have significantly declined.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Requirements: Based on studies of microsatellite loci, Bernatchez et al. (2002) recommended that each population in Maine be treated as a separate management unit in order to maximize the presevation of genetic variability within the Laurentian arctic char ESU.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Arctic char

Arctic char or Arctic charr, Salvelinus alpinus, is a cold-water fish in the family Salmonidae, native to arctic, subarctic and alpine lakes and coastal waters. It breeds in fresh water, and populations can be either landlocked or anadromous, migrating to the sea.[2] No other freshwater fish is found as far north; it is, for instance, the only fish species in Lake Hazen on Ellesmere Island in the Canadian Arctic. It is one of the rarest fish species in Britain, found only in deep, cold, glacial lakes, and is at risk from acidification. In other parts of its range, such as Scandinavia, it is much more common, and is fished extensively. It is also common in the Alps, (particularly in Trentino and the mountainous part of Lombardy), where it can be found in lakes up to an altitude of 2,600 m (8,500 ft) above sea level, and in Iceland. In Siberia, it is known as golets and it has been introduced in lakes where it sometimes threatens less hardy endemic species, such as the small-mouth char and the long-finned char in Elgygytgyn Lake.

The Arctic char is closely related to both salmon and lake trout, and has many characteristics of both. The fish is highly variable in colour, depending on the time of year and the environmental conditions of the lake where it lives. Individual fish can weigh 20 lb (9.1 kg) or more with record-sized fish having been taken by angling in northern Canada, where it is known as iqaluk or tariungmiutaq in Inuktitut. Generally, whole market-sized fish are between 2 and 5 lb (0.91 and 2.27 kg). The flesh colour can range from a bright red to a pale pink.

Subspecies[edit]

In North America, three subspecies of Salvelinus alpinus exist. S. a. erythrinus is native to almost all of Canada's northern coast. This subspecies is nearly always anadromous. S. a. oquassa, known as the Sunapee trout or the blueback trout, is native to eastern Quebec and northern New England, although it has been extirpated from most of its eastern United States range. S. a. oquassa is never anadromous. Taranets char and the dwarf Arctic char are both classified as S. a. taranetzi.

Arctic char are also found in Lake Pingualuit, a lake formed roughly 1.4 million years ago from an impact crater. Changing water levels are believed to have connected the lake with glacial runoff and surrounding streams and rivers, allowing char to swim upstream into the lake. Arctic char are the only fish found in the lake, and signs of fish cannibalism have been found.[3]

Farming[edit]

Arctic Char

Research aimed at determining the suitability of Arctic char as a cultured species has been going on since the late 1970s. The Canadian government's Freshwater Institute of Fisheries and Oceans Canada at Winnipeg, Manitoba, and the Huntsman Marine Science Centre of New Brunswick, pioneered the early efforts in Canada. Arctic char are also farmed in Iceland, Estonia, Norway, Sweden, Finland, West Virginia,[4] and Ireland.

Arctic char were first investigated because they were expected to have low optimum temperature requirements and would grow well at the cold water temperatures present in numerous areas of Canada. They could be an alternate species to rainbow trout and could provide producers with a different niche in the marketplace. The initial research efforts concentrated on identifying the culture needs and performance characteristics of the species. The Freshwater Institute was responsible for distributing small numbers of char eggs to producers in Canada; these producers in return helped determine the suitability of char in a commercial setting. Commercial char breeding stocks have now been developed largely from these sources.

The Monterey Bay Aquarium "Seafood Watch" program has recently added farmed Arctic char as an environmentally sustainable Best Choice for consumers, stating: "Arctic char use only a moderate amount of marine resources for feed. In addition, Arctic char are farmed in land-based, closed systems that minimize the risk of escape into the wild."[5]

As food[edit]

Commercial Arctic char typically weigh between 2 and 10 lb (1 and 4.5 kg). The flesh is fine flaked and medium firm. The colour is between light pink and deep red, and the taste is like something between trout and salmon.[6]

Diet[edit]

The char diet varies with the seasons. During late spring and summer, they feed on insects found on the water's surface, salmon eggs, snails and other smaller crustaceans found on the lake bottom, and smaller fish up to a third of the char's size. During the autumn and winter months the Char feeds on zoo plankton and freshwater shrimps that are suspended in the lake and also occasionally feeds on smaller fish.

Spawning[edit]

Spawning takes place from September to November over rocky shoals in lakes with heavy wave action and in slower gravel-bottom pools in rivers. As with most salmonids, vast differences in coloration and body shape occur between sexually mature males and females. Males develop hooked jaws known as kypes and take on a brilliant red colour. Females remain fairly silver. Most males set up and guard territories and often spawn with several females. The female constructs the nest, or redd. A female anadromous char usually deposits from 3,000 to 5,000 eggs. Char do not die after spawning like Pacific salmon and often spawn several times throughout their lives, typically every second or third year. Young char emerge from the gravel in spring and stay in the river from 5 to 7 months or until they are about 6–8 in (15–20 cm) in length.

References[edit]

  1. ^ J. Freyhof & M. Kottelat (2008). "Salvelinus alpinus". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved October 13, 2013. 
  2. ^ Cambridge Bay Arctic Char at Fisheries and Oceans Canada
  3. ^ E. A. Keller, R. H. Blodgett & J. J. Clague (2010). The Catastrophic Earth, Natural Disasters. Pearson Custom Publishing. ISBN 9780536878137. 
  4. ^ ARC | Mining Fresh Water for Aquaculture
  5. ^ Seafood Watch Newsletter, August 2006, Monterey Bay Aquarium, Monterey, California, USA
  6. ^ "Chef's Resources - Arctic Char Profile". Chefs-resources.com. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The Arctic char has a holarctic distribution and exhibits a complex pattern of variability in morphology, coloration, ecology, and life history (Behnke 1972), molded by glacial events during the Pleistocene.

Brunner et al. (2001) examined phylogeography of the Salvelinus alpinus complex using mtDNA sequences. They assigned the 63 observed haplotypes to five geographic regions that may be associated with different glacial refugia. Patterns of genetic variation did not entirely reflect the magnitude of phenotypic and ecological polymorphism in the S. alpinus complex, and not all taxa suggested by current taxonomy could be confirmed. Major groups were observed, but additional distinct lineages were also identified. There was a clear distinction between Acadian (Maine, southern Quebec) and Arctic (arctic North America, Alaska, Kamchatka Peninsula) populations, supporting current taxonomy that recognizes them as different subspecies, S. a. oquassa and S. a. erythrinus. Subspecies oquassa comprises landlocked populations from southeastern Quebec, New Brunswick, and the northeastern United States. Salvelinus a. erythrinus comprises an arctic group and a newly identified Siberian group. Salvelinus a. taranetzi is included in the Arctic cluster, but it exhibits a distinct and unique haplotype, supporting Behnke's (1984) suggestion that it be recognized as a distinct taxon. The Beringean group, formed entirely by specimens assigned to S. malma (Dolly Varden), encompassed the area formerly assigned to Salvelinus a. taranetzi; the Beringean group could not be confirmed as the sister taxon to all other Salvelinus alpinus, and the species status of S. malma was regarded as questionable. Five nominal subspecies fell into the Siberian group and all were genetically undifferentiated.

Sunapee, blueback (or blue backed), and Quebec red trouts, here included in Salvelinus alpinus, have been regarded as distinct species by some authors. Subspecies AUREOLUS was synonymized with subspecies oquassa by Qadri (1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!