Overview

Distribution

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (5000-200,000 square km (about 2000-80,000 square miles)) Range includes Clear Lake; and the Russian, Sacramento-San Joaquin, and Pajaro-Salinas river drainages, California (Moyle 2002, Page and Burr 2011). Non-native populations are established in some areas, including Silverwood and Pyramid reservoirs in southern California (Moyle 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Range includes Clear Lake; and the Russian, Sacramento-San Joaquin, and Pajaro-Salinas river drainages, California (Moyle 2002, Page and Burr 2011). Non-native populations are established in some areas, including Silverwood and Pyramid reservoirs in southern California (Moyle 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Hysterocarpus traskii
Catalog Number: USNM 31186
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Unknown
Locality: Probably From California, California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes small to large, low-elevation rivers; lake; and estuarine sloughs. This species is found in a wide variety of habitats, including slow or swift-flowing water where conditions are clear or turbid, but usually it occurs in cool, well-oxygenated water with emergent aquatic vegetation, deep pools, and banks with complex cover (Moyle 1976, 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes small to large, low-elevation rivers; a large lake; and estuarine sloughs. This species is found in a wide variety of habitats, including slow or swift-flowing water where conditions are clear or turbid, but usually it occurs in cool, well-oxygenated water with emergent aquatic vegetation, deep pools, and banks with complex cover (Moyle 1976, 2002).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Benthic and planktonic invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: This species is represented by a fairly large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but apparently quite large (likely greater than 100,000). This species is still abundant in portions of its range (Moyle 1976, 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Mating occurs July-September. Sperm stored until January when fertilization occurs. Viviparous; young born in May or June (Moyle 1976). Fecundity varies female size, 20-80 young (Lee et al. 1980). Young sexually mature a few weeks after birth. Lives up to 7 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hysterocarpus traskii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCTGGGATAGTGGGCACTGGCCTTAGTCTACTAATCCGGGCAGAACTAAGCCAACCAGGCGCTCTCCTTGGAGATGACCAAATTTATAATGTAATTGTAACGGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATACCGGTCATAATTGGAGGCTTTGGAAACTGACTTGTTCCACTAATAATTGGTGCCCCTGATATGGCCTTTCCTCGAATAAACAACATAAGTTTCTGACTGCTTCCTCCGTCGTTTCTTCTCCTTCTAGCATCTTCTGGTGTAGAAGCTGGTGCCGGAACCGGATGAACTGTTTATCCACCTCTTTCAGGCAATCTTGCTCATGCAGGAGCTTCCGTAGACTTAACTATTTTCTCCCTTCATCTTGCAGGAATTTCCTCAATTTTAGGTGCAATTAACTTCATCACAACTATTTTTAATATAAAGCCCCCAACTGTTTCACAGTATCAAATACCCCTATTTGTCTGATCTGTCCTAATTACAGCCGTGCTTCTGCTTCTTTCTCTTCCAGTTCTTGCTGCTGGGATCACTATGCTTCTAACTGACCGTAACCTAAATACTACTTTCTTTGACCCGGCAGGTGGTGGGGATCCCATTCTTTACCAGCACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hysterocarpus traskii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Distribution and abundance have declined over the long term, but the species is listed as Least Concern because the extent of occurrence, area of occupancy, number of locations, and population size are still quite large, and the species probably is not declining fast enough to qualify for any of the threatened categories.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Trend over the past 10 years or three generations is uncertain but probably relatively stable or slowly declining.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a fairly large number of occurrences (subpopulations).

Total adult population size is unknown but apparently quite large (likely greater than 100,000). This species is still abundant in portions of its range (Moyle 1976, 2002).

Abundance is greatly reduced from historical levels (Moyle 1976, 2002), particularly in the Pajaro-Salinas and San Joaquin river drainages. The species is still common in Clear Lake, but (considering changes in land and shore use and expected new introductions of alien species) its future there is by no means secure (Moyle 2002). Abundance in the Russian River apparently declined between the early 1970s and late 1980s (Moyle 2002).

Trend over the past 10 years or three generations is uncertain but probably relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Decline is apparently due primarily to habitat alterations (Moyle 1976, 2002). This species' viviparity seems to reduce its vulnerability to competition and predation from alien fishes, yet non-native fish species pose a continual potential threat (Moyle 2002). Decline in the Pajaro-Salinas and San Joaquin river drainages may have resulted from poor water quality and toxic chemicals (Moyle 2002). An apparent long-term decline in the San Francisco Estuary possibly is related to increased populations of centrarchids (Moyle 2002). Decline in the Russian River is probably related to habitat alteration caused by dams and decreased water quality from agricultural development; the latter also increases the potential for pesticide spills and other disasters (Moyle 2002).

This species seems to be able to persist in small numbers as long as suitable cover and water quality are present (Moyle 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Decline is apparently due primarily to habitat alterations (Moyle 1976, 2002). This species' viviparity seems to reduce its vulnerability to competition and predation from alien fishes, yet non-native fish species pose a continual potential threat (Moyle 2002). Decline in the Pajaro-Salinas and San Joaquin river drainages may have resulted from poor water quality and toxic chemicals (Moyle 2002). An apparent long-term decline in the San Francisco Estuary possibly is related to increased populations of centrarchids (Moyle 2002). Decline in the Russian River is probably related to habitat alteration caused by dams and decreased water quality from agricultural development; the latter also increases the potential for pesticide spills and other disasters (Moyle 2002).

This species seems to be able to persist in small numbers as long as suitable cover and water quality are present (Moyle 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tule perch

The tule perch Hysterocarpus traskii is a surfperch (Embiotocidae) native to the rivers and estuaries of central California, United States of America. It is the sole member of its genus, and the only freshwater surfperch.

The tule perch is small, at most 15 cm in length, and deep-bodied, with a definite hump shape between the head and the dorsal fin. Color is variable, with a dark back that may have a bluish or purplish cast, and a whitish or yellowish belly. The sides may have a pattern of narrow or wide bars; the frequency of barred patterns varies according to subspecies. The dorsal fin has a noticeable ridge of scales running along its base, and consists of 15-19 spines followed by 9-15 soft rays. The anal fin has 3 spines and 20-16 soft rays, while the pectoral fins have 17-19 rays.

They are fish of the lowlands, inhabiting lakes, sloughs, streams, and rivers, generally in areas with beds of vegetation or overhangs. They generally gather in groups, sometimes in large numbers. Their diet is primarily small invertebrates sucked up from the bottom or picked from the midwater column.

There are currently two subspecies of Tule perch recognized by FishBase:

  • Hysterocarpus traskii traskii Gibbons, 1854, the Russian River tule perch, originally occurred throughout Clear Lake, the Russian River, the Sacramento River-San Joaquin River and out into the estuaries around San Francisco Bay and the Pajaro River-Salinas River drainages. It is still common as far north as the Pit River, although it has mostly disappeared from the San Joaquin basin. The only unbarred fish occur in this subspecies, about 43% existing in this color pattern.

The formal description of the tule perch was first read by W. P. Gibbons at a meeting of the California Academy of Natural Sciences on May 15, 1854, and then published in the San Francisco newspaper The Daily Placer Times and Transcript on May 18, making it a rare case of a new species being published in a newspaper rather than book or scientific journal. Gibbons chose the genus name Hysterocarpus "womb-fruit" referring to the livebearing common to all surfperches, and traskii (sometimes seen as traski) in honor of J. B. Trask who sent Gibbons the first specimens of this fish.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Monotypic genus; the only exclusively freshwater embiotocid. Includes subspecies pomo from the Russian River drainage, lagunae from the Clear Lake drainage basin, and traskii from the main Sacramento-San Joaquin drainage; the three subspecies show some genetic divergence (Baltz and Loudenslager 1984). Original spelling ends with -ii (Nelson et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!