Overview

Distribution

California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: California endemic: low elevation waters of Sacramento River system, including Pit River up to Pit Falls; Clear Lake, Lake County; Russian River; common in north (Page and Burr 1991), extinct in Pajaro-Salinas and San Joaquin River systems (Lee et al. 1980). Introduced in some small lakes and ponds in California (McGinnis 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 15 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Hysterocarpus traskii
Catalog Number: USNM 31186
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Unknown
Locality: Probably From California, California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Small to large, low-elevation rivers; lakes. Found in a wide variety of habitats, slow or swift-flowing, clear or turbid water, but usually found in sections with emergent aquatic vegetation or overhanging banks, with sand and gravel bottoms (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Benthic and planktonic invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Mating occurs July-September. Sperm stored until January when fertilization occurs. Viviparous; young born in May or June (Moyle 1976). Fecundity varies female size, 20-80 young (Lee et al. 1980). Young sexually mature a few weeks after birth. Lives up to 7 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hysterocarpus traskii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCTGGGATAGTGGGCACTGGCCTTAGTCTACTAATCCGGGCAGAACTAAGCCAACCAGGCGCTCTCCTTGGAGATGACCAAATTTATAATGTAATTGTAACGGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATACCGGTCATAATTGGAGGCTTTGGAAACTGACTTGTTCCACTAATAATTGGTGCCCCTGATATGGCCTTTCCTCGAATAAACAACATAAGTTTCTGACTGCTTCCTCCGTCGTTTCTTCTCCTTCTAGCATCTTCTGGTGTAGAAGCTGGTGCCGGAACCGGATGAACTGTTTATCCACCTCTTTCAGGCAATCTTGCTCATGCAGGAGCTTCCGTAGACTTAACTATTTTCTCCCTTCATCTTGCAGGAATTTCCTCAATTTTAGGTGCAATTAACTTCATCACAACTATTTTTAATATAAAGCCCCCAACTGTTTCACAGTATCAAATACCCCTATTTGTCTGATCTGTCCTAATTACAGCCGTGCTTCTGCTTCTTTCTCTTCCAGTTCTTGCTGCTGGGATCACTATGCTTCTAACTGACCGTAACCTAAATACTACTTTCTTTGACCCGGCAGGTGGTGGGGATCCCATTCTTTACCAGCACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hysterocarpus traskii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Decline apparently due primarily to habitat alterations (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tule perch

The tule perch Hysterocarpus traskii is a surfperch (Embiotocidae) native to the rivers and estuaries of central California, United States of America. It is the sole member of its genus, and the only freshwater surfperch.

The tule perch is small, at most 15 cm in length, and deep-bodied, with a definite hump shape between the head and the dorsal fin. Color is variable, with a dark back that may have a bluish or purplish cast, and a whitish or yellowish belly. The sides may have a pattern of narrow or wide bars; the frequency of barred patterns varies according to subspecies. The dorsal fin has a noticeable ridge of scales running along its base, and consists of 15-19 spines followed by 9-15 soft rays. The anal fin has 3 spines and 20-16 soft rays, while the pectoral fins have 17-19 rays.

They are fish of the lowlands, inhabiting lakes, sloughs, streams, and rivers, generally in areas with beds of vegetation or overhangs. They generally gather in groups, sometimes in large numbers. Their diet is primarily small invertebrates sucked up from the bottom or picked from the midwater column.

The tule perch occurs in three separate areas in California, which have become differentiated into subspecies:

  • Hysterocarpus traskii lagunae, the Clear Lake tule perch, is native to Clear Lake and the two Blue Lakes. Although threatened by alien fish introductions and loss of habitat, it remains common in the lake. A broad-barred color pattern is common only in this subspecies, at 27% of individuals.

The formal description of the tule perch was first read by W. P. Gibbons at a meeting of the California Academy of Natural Sciences on May 15, 1854, and then published in the San Francisco newspaper The Daily Placer Times and Transcript on May 18, making it a rare case of a new species being published in a newspaper rather than book or scientific journal. Gibbons chose the genus name Hysterocarpus "womb-fruit" referring to the livebearing common to all surfperches, and traskii (sometimes seen as traski) in honor of J. B. Trask who sent Gibbons the first specimens of this fish.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Monotypic genus; the only exclusively freshwater embiotocid. Includes subspecies pomo from the Russian River drainage, lagunae from the Clear Lake drainage basin, and traskii from the main Sacramento-San Joaquin drainage; the three subspecies show some genetic divergence (Baltz and Loudenslager 1984). Original spelling ends with -ii (Nelson et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!