Overview

Brief Summary

The Pacific herring, Clupea pallasii, is one of three species of herring family (genus Culpea). It is a silvery fish with unspined fins and a deeply forked caudal fin. Clupea pallasii inhabits the Pacific Ocean environment of North America and northeast Asia. It occurs widely along the California coast from Baja California north to Alaska and the Bering Sea and in Asia south to Japan. Clupea pallasii is sometimes considered a keystone species because of its very high productivity and interactions with a large number of predators and prey. Pacific herring spawn in variable seasons, but often in the early part of the year in intertidal and sub-tidal environments, commonly on eelgrass or other submerged vegetation. They do not die after spawning, but can breed in successive years. According to government sources, the Pacific herring fishery collapsed in the year 1993, and is slowly recovering to commercial viability in several North American stock areas. The species is named for Peter Simon Pallas, a noted German naturalist and explorer. (Barnhart 1988; Wikipedia 2011)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Northeast Atlantic: White Sea, mainly in the western and southern portions. Subspecies status needs confirmation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Range encompasses coastal areas of the North Pacific Ocean from northern Baja California to the Beaufort Sea, and south in the western Pacific to Japan and Korea; also Arctic coast of Eurasia from the Chukchi Sea to the White Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 16 - 22; Analsoft rays: 13 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 460 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

34.0 cm TL (male/unsexed; (Ref. 593))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Unconfirmed type for Clupea pallasii
Catalog Number: USNM 53972
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Unalaska, Unalaska Island, Alaska, United States, Aleutian Islands, Pacific
Vessel: Albatross
  • Unconfirmed type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; non-migratory; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3314 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1668 samples.

Environmental ranges
  Depth range (m): 0 - 254.5
  Temperature range (°C): -0.959 - 8.705
  Nitrate (umol/L): 2.534 - 34.597
  Salinity (PPS): 28.657 - 33.906
  Oxygen (ml/l): 2.565 - 8.596
  Phosphate (umol/l): 0.354 - 2.965
  Silicate (umol/l): 11.425 - 54.528

Graphical representation

Depth range (m): 0 - 254.5

Temperature range (°C): -0.959 - 8.705

Nitrate (umol/L): 2.534 - 34.597

Salinity (PPS): 28.657 - 33.906

Oxygen (ml/l): 2.565 - 8.596

Phosphate (umol/l): 0.354 - 2.965

Silicate (umol/l): 11.425 - 54.528
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Pacific herrings live in coastal waters and often occur offshore. Adults move toward shore and enter bays and estuaries prior to spawning. Eggs are sticky and adhere to eelgrass, kelp, and other objects. Juveniles congregate in bays, inlets, and channels in summer. In fall, they move to deeper water and remain there until the mature about 2-3 years later.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 150m.
Recorded at 150 meters.

Habitat: pelagic. Occurs in coastal waters. Possibly to 475 m depth (Ref. 6793). During the summer of their first year, juveniles form schools that apear on the surface. These schools disappear in the fall and remain in deep water for the next 2-3 years (Ref. 6885). Mature adults migrate inshore (entering estuaries) to breed from December to July, depending on the latitude. Does not show strong north-south migrations, the population being localized. Landlocked populations exist in the western Pacific. Larvae feed on ostracods, small copepods and their nauplii, small fish larvae, euphausids, and diatoms; juveniles feed mainly on crustaceans but also on small fishes, marine worms, and larval clams; adults prey mainly on large crustaceans and small fishes (Ref. 6885). Larvae are preyed upon by pilchards, ctenophores, jellyfishes, and chaetognaths while adults are preyed upon by waterfowl, sharks, lingcod, sea lions, and whales (Ref. 6885). Utilized fresh, dried/salted, smoked, canned, and frozen; eaten pan-fried, broiled, and baked. In eastern Pacific, the fish is mainly caught for roe markets in Asia (Ref. 9988). Eggs laid on kelp, called Kazunoko-kombu, are salted and sold with the kelp and are an extremely expensive delicacy. Used in Chinese medicine (Ref. 12166).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19 years (wild) Observations: Mortality rate increases with age have been reported for wild populations (Patnaik et al. 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

In California, the spawning season extends from November to June (mainly winter). In Alaska, spawning occurs March-June, although the season may be shorter than this in a particular location. In large mass spawnings the water often appears milky over the entire spawning area due to the presence of abundant milt. Eggs hatch in 1-2 weeks, depending on the temperature.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Clupea pallasii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCAACTAATCACAAAGATATTGGTACCCTTTACCTAGTATTTGGTGCCTGAGCAGGAATGGTGGGCACAGCCCTAAGTCTCCTAATCCGTGCAGAACTTAGCCAACCTGGGGCCCTCCTTGGAGAC---GACCAGATCTATAATGTTATTGTTACTGCACATGCCTTCGTAATAATTTTCTTTATAGTAATGCCGATTCTAATTGGAGGGTTTGGAAACTGACTAATTCCTCTTATGATCGGAGCGCCAGATATGGCATTCCCTCGAATAAACAACATGAGCTTCTGACTACTTCCCCCCTCATTCCTCCTACTCCTAGCCTCCTCCGGAGTTGAAGCCGGGGCGGGAACCGGGTGAACGGTATATCCTCCTCTGTCAGGTAATCTGGCCCACGCAGGAGCATCAGTTGACCTAACCATTTTTTCACTTCATCTAGCAGGTATTTCCTCTATTCTAGGGGCCATCAATTTCATTACCACAATTATTAATATGAAACCACCCGCAATCTCACAATACCAAACGCCTCTGTTTGTCTGATCCGTTCTTGTTACAGCTGTTCTGCTTCTTCTATCGCTGCCTGTGCTAGCTGCCGGAATTACAATGCTTCTTACAGATCGAAACCTAAACACCACCTTCTTCGACCCAGCAGGAGGGGGAGACCCAATTCTTTACCAACACCTATTCTGATTTTTCGGACACCCGGAAGTGTATATTCTAATTCTTCCCGGGTTCGGAATGATTTCCCACATCGTAGCCTACTACGCGGGAAAGAAAGAACCCTTCGGATACATAGGAATGGTCTGAGCTATGATGGCCATCGGACTACTAGGGTTTATTGTATGAGCCCACCACATGTTCACCGTAGGAATGGATGTTGACACTCGAGCATACTTTACATCAGCAACTATAATTATTGCCATCCCAACCGGGGTTAAGGTATTTAGCTGACTTGCCACTCTCCACGGGGGC---TCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Clupea pallasii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pacific herring

The Pacific herring, Clupea pallasii, is a species of the herring family associated with the Pacific Ocean environment of North America and northeast Asia. It is a silvery fish with unspined fins and a deeply forked caudal fin. The distribution is widely along the California coast from Baja California north to Alaska and the Bering Sea; in Asia the distribution is south to Japan. Clupea pallasii is considered a keystone species because of its very high productivity and interactions with a large number of predators and prey. Pacific herring spawn in variable seasons, but often in the early part of the year in intertidal and sub-tidal environments, commonly on eelgrass or other submerged vegetation; however, they do not die after spawning, but can breed in successive years. According to government sources, the Pacific herring fishery collapsed in the year 1993, and is slowly recovering to commercial viability in several North American stock areas.[1] The species is named for Peter Simon Pallas, a noted German naturalist and explorer.

There are disjunct populations of Clupea pallasii in North-East Europe, which are often attributed to separate subspecies Clupea pallasii marisalbi (White Sea herring) and Clupea pallasii suworowi (Chosha herring).

Contents

Morphology [edit]

Pacific herring have a bluish-green back and silver-white sides and bellies; they are otherwise unmarked. The silvery color derives from guanine crystals embedded in their laterals, leading to an effective camouflage phenomenon.[2] There is a single dorsal fin located mid-body and a deeply forked tail-fin. Their bodies are compressed laterally, and ventral scales protrude in a somewhat serrated fashion. Unlike other genus members, they have no scales on heads or gills;[3] moreover, their scales are large and easy to extract. This species of fish may attain a length of 45 centimeters in exceptional cases and weigh up to 550 grams, but a typical adult size is closer to 33 centimeters. The fish interior is quite bony with oily flesh.

This species has no teeth on the jawline, but some are exhibited on the vomer. Pacific herring have an unusual retinal design that allows filter feeding in extremely dim lighting environments. This species is capable of rapid vertical motion, due to the existence of a complex nerve receptor system design that connects to the gas bladder.[4]

Life cycle [edit]

Juvenile fish

Pacific herring prefer spawning locations in sheltered bays and estuaries. Along the North American Pacific Coast, some of the principal areas are San Francisco Bay, Richardson Bay, Tomales Bay and Humboldt Bay. Adult males and females make their way from the open ocean to these bays around November or December, although in the far north of the range, these dates may be somewhat later. Conditions that trigger spawning are not altogether clear, but after spending weeks congregating in the deeper channels, both males and females will begin to enter shallower inter-tidal or sub-tidal waters. Submerged vegetation, especially eelgrass, is a preferred substrate for oviposition. A single female may lay as many as 20,000 eggs in one spawn following ventral contact with submerged substrates. However, the juvenile survival rate is only about one resultant adult per ten thousand eggs, due to high predation by numerous other species.

The precise staging of spawning is not understood, although some researchers suggest the male initiates the process by release of milt, which has a pheromone that stimulates the female to begin oviposition. The behavior seems to be collective so that an entire school may spawn in the period of a few hours, producing an egg density of up to 6,000,000 eggs per square meter.[5] The fertilized spherical eggs, measuring 1.2 to 1.5 millimeters in diameter, incubate for approximately ten days in estuarine waters that are about 10 degrees Celsius. Eggs and juveniles are subject to heavy predation.

Fisheries [edit]

Global capture of Pacific herring in tonnes reported by the FAO, 1950–2009[6]

Historically the Pacific herring has been an important species, due to its productive abilities to generate significant species biomass. Biomass estimates have been performed by scuba divers from the Alaska Department of Fish and Game since 1975 but the estimates remain highly variable.[7]

Due to overfishing,[8] the total North American Pacific herring fishery collapsed in 1993, and is slowly recovering with active management by North American resource managers. In various sub-areas the Pacific herring fishery collapsed at slightly differing times; for example, the Pacific herring fishery in Richardson Bay collapsed in 1983.[9] The species has been re-appearing in harvestable numbers in a number of North American fisheries including San Francisco Bay, Richardson Bay, Tomales Bay, Sitka Sound, Half Moon Bay and Humboldt Bay. In other areas, such as Auke Bay, which, in the late 1970s was the largest harvestable stock of herring in Alaska, the species remains severely depleted.[10]

Pacific herring are currently harvested commercially for salmon bait and for roe. Past commercial uses included fish oil and fish meal.[10]

Conservation [edit]

On April 2, 2007, the Juneau group of the Sierra Club submitted a petition to list Pacific herring in the Lynn Canal, Alaska, area as a threatened or endangered distinct population segment under the criteria of the U.S. Endangered Species Act (ESA).[11] On April 11, 2008, that petition was denied because the Lynn Canal population was not found to qualify as a distinct population segment. However, the National Marine Fisheries Service did announce would be initiating a status review for a wider Southeast Alaska distinct population segment of Pacific herring that includes the Lynn Canal population.[12] The Southeast Alaska DPS of Pacific herring extends from Dixon Entrance northward to Cape Fairweather and Icy Point and includes all Pacific herring stocks in Southeast Alaska.

See also [edit]

References [edit]

  1. ^ Alaska Fisheries 1998 study
  2. ^ Hourston, A.S. and C.W. Haegele, Herring on Canada's Pacific Coast, Canadian Special Publications of Fisheries and Aquatic Sciences, Department of Fisheries and Oceans, Ottawa (1980)
  3. ^ Roger A. Barnhart, Species Profile: Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (Pacific Southwest): Pacific Herring, U.S. Fish and Wildlife Service, February, 1988
  4. ^ J.H.S. Blaxter, The Herring: a Successful Fish?, Journal of Canadian Journal of Fish. Aquatic Sci.(suppl. 1) 42:21-30 (1985)
  5. ^ J.D. Spratt, The Pacific herring resource of San Francisco and Tomales Bays: Its size and structure, California Department of Fish and Game Marine Research Tech. 33, 44p (1976)
  6. ^ Clupea pallasii (Valenciennes, 1847) FAO, Species Fact Sheet. Retrieved April 2012.
  7. ^ Hebert, KP (2011). "Scuba Diving Surveys Used to Estimate Pacific Herring Egg Deposition in Southeastern Alaska". In: Pollock NW, ed. Diving for Science 2011. Proceedings of the American Academy of Underwater Sciences 30th Symposium. Dauphin Island, AL: AAUS; 2011. Retrieved 2013-04-02. 
  8. ^ Dean, Cornelia (3 November 2006). "Study Sees 'Global Collapse' of Fish Species". New York Times. Retrieved 9 February 2010. 
  9. ^ Patrick Sullivan, Gary Deghi and C.Michael Hogan, Harbor Seal Study for Strawberry Spit, Marin County, California, Earth Metrics file reference 10323, BCDC and County of Marin, January 23, 1989
  10. ^ a b O'Clair, Rita M. and O'Clair, Charles E., "Pacific herring," Southeast Alaska's Rocky Shores: Animals. pg. 343-346. Plant Press: Auke Bay, Alaska (1998). ISBN 0-9664245-0-6
  11. ^ "Endangered Species Act". 
  12. ^ Announcement of initiation of status review for Southeast Alaska Pacific herring
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly regarded as conspecific with the Atlantic herring, C. HARENGUS. Based on a study of biochemical genetics, Grant (Copeia 1986:714) recognized HARENGUS and PALLASI as distinct species, an action followed in the 1991 AFS checklist (Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!