Overview

Comprehensive Description

Biology

An inhabitant of deep, cold water (Ref. 7251). Benthic (Ref. 58426). Feed on all kinds of bottom animals (Ref. 3167). Oviparous (Ref. 50449). Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205). Eggs are oblong capsules with stiff pointed horns at the corners deposited in sandy or muddy flats (Ref. 205). Egg capsules are 13.4-16.5 cm long and 8.0-10.2 cm wide (Ref. 41251, 41301).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Greenland side of the Davis Strait to Georges Bank
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Spinytail Skate is a deep-sea demersal elasmobranch found along the upper and middle continental slope from 140 to at least 1,650 m. In surveys off Canada (from 1995–2005), only 91 fish were taken for every thousand sets at depths <1,000 m, and 401 fish per thousand sets at >1,000 m. Increasing density with depth out to the deepest areas sampled may indicate that a large proportion of the population occurs in waters deeper than those surveyed or fished. Outside Canada, Spinytail Skate is typically reported at 400–850 m depth, but few data exist at greater depths. The species is probably cosmopolitan along the continental slopes (200–2,000 m) of the Arctic and boreal regions of the North Atlantic.

Extent of occurrence in the northwest Atlantic, concurrent with the annual survey footprint, is 300,000 km² although the species likely also occupies a large area below the depth of the annual surveys.

In the eastern Atlantic, it is found from eastern Greenland, Iceland, along the Iceland-Færoe-Shetland Rise to the coasts of Norway, the northern North Sea, and the Barents Sea (Bigelow and Schroeder 1953, Krefft 1956, Stehmann and Bürkel 1984). In the western Atlantic Ocean, it occurs in the Davis Strait, off the coast of Newfoundland and Labrador, the Grand Banks and Flemish Cap, the Gulf of St. Lawrence, the Scotian Shelf, the eastern slope of Georges Bank south to Nantucket, and occasionally in the Gulf of Maine (Bigelow and Schroeder 1953, Schroeder 1955, Krefft 1956, Leim and Scott 1966, Scott and Scott 1988, McEachran 2002).

There are also some records in the Southern Indian Ocean in the vicinity of Kerguélen Islands (Scott and Scott 1988, Hureau 1991, Froese and Pauly 2002). However, these Southern Ocean records require confirmation and may represent misidentifications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Greenland side of Davis Strait and off the east coast of Newfoundland, Canada to off Georges Bank. Eastern Atlantic: Barents Sea, Norway, Iceland-Faroes-Shetland Rise and eastern Greenland (Ref. 3167).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic including northern North Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

170 cm TL (male/unsexed; (Ref. 3167))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Disk without spines, except near edge of pectoral fins in males. Ventral mucous pores not blackish. Tail with middorsal row of large spines. Snout pointed (Ref. 7251). Upper surface pale brown or bluish gray without dark markings. Lower surface white with small sooty blotches irregularly distributed around margins of pectorals, pelvic fins white below. Lower surface of tail white but pale brown rearward (Ref. 6902).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in deep, cold waters .
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Spinytail Skate is a deep-sea demersal elasmobranch found along the upper and middle continental slope from 140 to at least 1,650 m, but mainly >400 m in Canadian Atlantic waters. In surveys off Canada, only 91 fish were taken for every 1,000 sets at depths <1,000 m, 401 fish per thousand at >1,000 m (from 1995–2005). Increasing density with depth out to the deepest areas sampled may indicate that a large proportion of the population occurs in waters that exceed depths surveyed and depths fished (the continental slope extends to 2,000 m). Murua and Cardenas (2005) found that the range of Spinytail Skate in the area that they surveyed using baited longlines (the Flemish Cap and Pass, and nose and tail of the Grand Banks) was approximately 1,350–1,650 m. Northeast Atlantic records are typically at 400–850 m (deepest locations fished), but few data exist at greater depths. Icelandic deepwater fisheries, operating at 400–1,830 m, caught spinytail skate at depths ranging from 419–1,209 m (Magnússon et al. 2000).

The species is typically recorded at temperatures <7.5°C (mainly at 2.5–5°C in the northwest Atlantic), and salinities ranging from 34.5–35.5‰ (Krefft 1956, Stehmann and Bürkel 1984, Haedrich and Merrett 1988, Dolgov et al. 2002). In Canadian waters it is most densely concentrated where water temperatures are 2.5°–5°C (Kulka, pers. comm.). In the Barents and Norwegian Seas, spinytail skate are commonly found in water >0°C (Andriyashev 1954, Berestovskii 1994).

Spinytail Skate feeds on other skate species, redfish, sea bream, American plaice, cod, and pelagic fish species including capelin and sandlance (Baranenkova et al. 1962, Leim and Scott 1966, Stehmann and Bürkel 1984, Scott and Scott 1988) and in the Barents Sea were found to feed mainly on benthos as juveniles, switching to predominantly fish, up 90% of the diet of adults (Dolgov 2002).

Age or size at sexual maturation, growth, and lifespan of Spinytail Skate are unknown. This is one of the largest and hence potentially least resilient species of skate reported in the north Atlantic. The largest confirmed specimen in the northwest Atlantic is 172 cm total length (TL) (Bigelow and Schroeder 1953) and 182 cm TL in the northeast Atlantic (Dolgov 2002). Several female specimens exceeding 150 cm TL were shown to have reproduced (Kulka pers. obs.). The estimated generation time is about 20 years. A record in Baranenkova et al. (1962) of 330 cm TL far exceeds (nearly double) any other record and thus is questionable.

Egg cases thought to be Spinytail Skate have been found off the Labrador Shelf, the Banquereau Bank off Nova Scotia and the southwestern edge of Georges Bank (Bigelow and Schroeder 1953); however, problems exist with accurately identifying skate egg cases. Very recently, several large (>150 cm TL) female spinytail skates from the edge of the Labrador Shelf were found to have stretched oviducts, and fully formed egg cases indicate that reproduction takes place in that area (Kulka pers. comm.). In the eastern North Atlantic, juveniles are typically found in colder waters than adults; adults are believed to move into warmer waters before spawning (Krefft 1956).

There are no data on age or size of maturation for Spinytail Skate. Spawning was observed during June and July off Greenland; however, little is known about spawning elsewhere in the western north Atlantic (Breder and Rosen 1966). In the Barents Sea, females were found to have spawned in the latter half of October (Krefft 1956). The embryos in the egg cases of spinytail skate are very large, approximately 21cm long (Krefft 1956, Berestovskii 1994). Embryonic development is estimated at about 12 months (Stehmann and Bürkel 1984). However, recent research on spinytail skate in the Barents Sea has estimated embryonic development in waters 0–5°C to be 3.5–4 years (Berestovskii 1994).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 140 - 1463 m (Ref. 58426), usually 165 - 255 m (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1210 specimens in 1 taxon.
Water temperature and chemistry ranges based on 949 samples.

Environmental ranges
  Depth range (m): 51 - 1485
  Temperature range (°C): -0.403 - 10.084
  Nitrate (umol/L): 5.303 - 21.618
  Salinity (PPS): 33.260 - 35.064
  Oxygen (ml/l): 3.482 - 7.383
  Phosphate (umol/l): 0.593 - 1.716
  Silicate (umol/l): 3.764 - 25.595

Graphical representation

Depth range (m): 51 - 1485

Temperature range (°C): -0.403 - 10.084

Nitrate (umol/L): 5.303 - 21.618

Salinity (PPS): 33.260 - 35.064

Oxygen (ml/l): 3.482 - 7.383

Phosphate (umol/l): 0.593 - 1.716

Silicate (umol/l): 3.764 - 25.595
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 140 - 800m.
From 140 to 800 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

An inhabitant of deep, cold water (Ref. 7251). Feeds on Mallotus villosus (capelin) and Raja radiata (thorny skate) (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on a variety of bottom animals
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Oviparous (Ref. 3167). Paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathyraja spinicauda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAATCTTTGGTGCCTGAGCAGGGATGGTTGGGACTGGTCTTAGTCTTCTAATCCGAGCTGAATTAAGTCAACCTGGAACCCTTTTAGGTGATGATCAGATTTATAATGTTATTGTTACAGCCCATGCCTTTGTAATAATCTTCTTTATGGTTATGCCAATCATAATTGGAGGTTTCGGTAATTGGCTTGTCCCTTTAATGATTGGTTCTCCAGACATAGCTTTTCCACGCATAAATAATATAAGCTTCTGACTTCTGCCTCCATCTTTTCTTCTGCTTCTAGCCTCTGCCGGTGTTGAAGCTGGAGCAGGGACTGGCTGAACTGTTTATCCCCCACTAGCAGGAAATCTTGCCCATGCAGGAGCTTCCGTTGATTTAACAATTTTTTCTCTTCACTTAGCCGGAATCTCATCTATCTTAGCATCAATTAATTTTATTACTACTATTATTAATATAAAACCACCAGCAATCTCACAATACCAAACACCTTTATTTGTGTGATCAGTTCTTGTCACAACTGTACTACTTCTTTTAGCTCTCCCAGTTTTAGCAGCAGCTATCACTATACTTTTAACAGATCGTAATCTTAACACAACTTTCTTCGACCCTGCAGGGGGAGGAGATCCTATTTTATATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bathyraja spinicauda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Kulka, D.W., Orlov, A.M., Devine, J.A., Baker, K.D., & Haedrich. R.L.

Reviewer/s
Kyne, P.M., Dulvy, N.K., Fowler, S.L. & IUCN SSG RL Expert Panel (Shark Red List Authority)

Contributor/s

Justification
Spinytail Skate (Bathyraja spinicauda) is a deep-sea skate found along the North Atlantic continental slope from 140 to at least 1,650 m. Its population density increases with depth, suggesting that it may extend into waters that exceed depths surveyed or commercially fished, although few data exist at these greater depths. Most life history parameters are unknown, but this is one of the largest species of skates recorded from the Atlantic and it is likely to have a low resilience to fisheries. Deepwater fishing effort and distribution in the northwest Atlantic has been greatly reduced since its peak in the early 1970s. Spinytail Skate still comprises the most common bycatch skate species in the slope fishery for Greenland Halibut (Reinhardtius hippoglossoides) off the Grand Bank to Labrador Shelf and thus is vulnerable to fishing pressure, but effort and quotas have recently been reduced in this fishery. Survey data from Canadian Atlantic waters demonstrated a population decline exceeding 80% and a 25% reduction in body size during 1978–1994, but it has been queried whether this trend is representative of the entire population, including poorly-surveyed deepwater areas, or part of the population only. In the northeast Atlantic, Spinytail Skate records are relatively rare suggesting that fishing and survey/fishing effort rarely overlap the depth range of the species there, although there is concern that fisheries are moving into deeper water here. That a large proportion of the population occurs outside of the area fished and surveyed, particularly in the northeast Atlantic, presently affords some protection against anthropogenic effects. The species is therefore assessed as Near Threatened globally, Vulnerable (VU A2b) in the northwest Atlantic and Least Concern in the northeast Atlantic, with concern expressed that fisheries and population trends should be monitored extremely carefully and the assessment revised when more data become available from deepwater.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Spinytail Skate is the most common slope skate species in areas surveyed off Canada. Records are less common across the northern slope to the northeast Atlantic and the Barents Sea (but surveys are also less intensive here). Population size and degree of fragmentation or migration through its distribution are unknown.

Devine et al. (2006) reported that Spinytail Skate declined in excess of 80% over three generations in Canadian waters of the northwest Atlantic surveyed. However, a large proportion of the population occurs in deeper water than the sampled areas used in this analysis, since abundance increases with depth in areas that are surveyed and it may also be abundant (or more abundant) below survey depths (see depth distribution description and maps attached of distribution and survey coverage). It is unknown, therefore, whether the trend in survey abundance reported in this paper is a reflection of population decline or simply a reduction in local abundance.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Skates (all species) are a minor part of the bycatch in many deepwater fisheries in Canada and elsewhere (e.g., Kulka et al. 1996, Kulka and Mowbray 1999). Trawl fisheries catch the most Spinytail Skate. Skate bycatch, all species combined, made up only 1% of the catch in Canadian commercial offshore fisheries (Kulka et al. 1996). Based upon observer data, spinytail skate made up 10% of the skate bycatch in offshore Canadian commercial fisheries 1985–1995, or 0.1% of all catches (Kulka et al. 1996). Spinytail Skate are now taken predominantly in the northern deeper water fisheries, since the closure of several groundfish fisheries. Overall, deep water fishing effort in the northwest Atlantic peaked in the early 1970s and has since been greatly reduced from past years, both in terms of effort and area fished.

Spinytail Skate is a very minor bycatch species in the directed Thorny Skate Amblyraja radiata fishery located in relatively shallow water (average depth 165m) on the Grand Bank (Kulka and Mowbray 1999). The shallow water Scotian Shelf skate fishery does not capture spinytail skate either (Simon and Frank 2000). However, Spinytail Skate is the dominant skate bycatch species in the deepwater fishery for Greenland Halibut (Kulka pers. obs.). Most Spinytail Skate caught in this fishery were discarded; observed discards were 50% or greater than the total observed catch for years 1981–2001. Data provided by the Department of Fisheries and Oceans (DFO), by fishery (line, trawl and gillnet) for Spinytail Skate 1981–2001 also indicate that trawl fisheries catch the largest proportion of the species. These fisheries reached depths of about 1,600 m, but catches tailed off with increasing depth below 1,250 m. Effort in the Canadian halibut fishery has fallen.

Devine et al. (2006) analysed DFO survey data for the shelf and slope to a depth of 1,485 m, restricting their data analysis to strata consistently sampled for at least half the time period and two years out of the first and last five years. They concluded that Spinytail Skate had declined 87.6% (95% confidence intervals 84.4–95.9%) in Canadian waters of the northwest Atlantic over the 17 year period 1978–1994. Extrapolating this to the estimated three generation period for this species resulted in a decline over 100% (theoretical regional extinction). Furthermore, declines in mean body size 1978–1994 were estimated to be 25.5% (95% confidence interval = 1.3–43.8%). However, other Red List assessors for this species considered that the DFO shelf surveys do not adequately measure the population status of slope species, including Spinytail Skate, which also occur below the depth range of the main survey data and are far more widely distributed than in the area surveyed. Thus, it was uncertain whether the reported reduction in survey index is the result of a change in density that did not occur elsewhere. Further data are required from deeper waters to enable trend analyses to be extended into deeper water.

Outside Canada’s 200 mile limit, skates are the second most common bycatch species in the Spanish trawl fishery for Greenland halibut (1991–1994); however, the majority of the skate bycatch is Thorny Skate Amblyraja radiata (Junquera and Paz 1998, Durán et al. 1996). Skates also make up a significant amount of the bycatch reported in other fisheries to NAFO (Durán and Paz 1997). Most of the skate bycatch of these fisheries is retained (Kulka and Mowbray 1999).

Fishing activities in the northeast Atlantic are moving into deeper water and effort is increasing, which is some cause for concern and requires careful monitoring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Spinytail Skate is not currently protected or regulated, but it is a mid-priority candidate species for detailed status assessment by COSEWIC (Committee on the Status of Endangered Wildlife in Canada). Continued monitoring is essential to document catch, discard and retention levels.

While quotas exist in Canadian waters for Thorny Skate, there are none in place for Spinytail Skate. The Greenland Halibut fishery in which Spinytail Skate is taken as bycatch is regulated for the target species, and as such this has a secondary effect on levels of bycatch. Effort in fishing for both Greenland halibut and grenadier has decreased in Canadian waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the genus Raja; McEachran and Dunn (1998) included this species in the genus Bathyraja.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!