Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Betulaceae -- Birch family

    G. G. Erdmann

    Yellow birch (Betula alleghaniensis) is  the most valuable of the native birches. It is easily  recognized by the yellowish-bronze exfoliating bark for which it  is named. The inner bark is aromatic and has a flavor of  wintergreen. Other names are gray birch, silver birch, and swamp  birch. This slow-growing long-lived tree is found with other  hardwoods and conifers on moist well-drained soils of the uplands  and mountain ravines. It is an important source of hardwood  lumber and a good browse plant for deer and moose. Other wildlife  feed on the buds and seeds.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

G. G. Erdmann

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

This tree is typically 60-75' tall at maturity with a single trunk that spans up to 3½' across. In open areas, the crown is large and widely spreading, while in dense forested areas it is small and irregular. For the typical variety of Yellow Birch, trunk bark is grayish yellow to bronze and somewhat lustrous, peeling away in papery sheets that are curled along their margins. For a more southern variety (var. fallax), trunk bark is gray to dark brown and wrinkled; it does not exfoliate to the same extent as the bark for the typical variety of this tree. The bark of branches and twigs is reddish brown, brown, or gray with scattered white lenticels; their inner bark has a mild wintergreen aroma. Young shoots and spur shoots are light green and usually pubescent. The leaves are arranged alternately along the twigs on short spur-shoots; there are one or two leaves per spur-shoot. The leaf blades are 2½-4' long and 1¼-2½' across; they are ovate in shape and doubly serrated along their margins. The upper surface of these blades is dark green and either glabrous or sparsely covered with short stiff hairs; the lower surface is medium green and pubescent along the veins. The petioles are ¼-½' long, pale green, and short-pubescent. Yellow Birch is monoecious, forming male (staminate) and female (pistillate) catkins on the same tree. Male catkins occur at the tips of last year's twigs in groups of 3-6. During the blooming period, they droop downward and become 2½-4' long. At this time, the male catkins are narrowly cylindrical and yellowish purple. Each male catkin consists of numerous male florets and their bracts. Male florets occur in groups of 3 behind each bract; each male floret consists of 2 stamens. Each bract is oval-orbicular in shape and ciliate along its margins. Female catkins occur individually on short spur-twigs near the petioles of leaves; they are sessile or nearly so. The female catkins are upright, ovoid-oblongoid in shape, and greenish, ultimately becoming ¾-1¼' in length at maturity. Each female catkins consists of numerous female florets and their bracts. Female florets occur in groups of 3 behind each bract; each female floret consists of a naked ovary and a pair of styles. The bracts are ¼-½' long, 3-lobed and ciliate along their margins. The blooming period occurs during late spring for about 1 week. The florets are cross-pollinated by the wind. The female catkins turn brown as their winged seeds (samaras) ripen. Each seed body is about 1/8' long, ellipsoid-ovoid in shape, and somewhat flattened. Membranous wings extend on opposite sides of each seed; they are a little less wide than the seed body. The woody root system is relatively shallow and widely spreading. This tree reproduces by reseeding itself.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

General: Birch Family (Betulaceae). These are native trees mostly 15-20(-30) m tall, with straight trunks and variable crowns; mature bark smooth and shiny, usually separating into thin layers, giving a shaggy appearance; lenticels dark, horizontally; twigs with odor and taste of wintergreen, usually with small resinous glands. Leaves are deciduous, alternate, simple, narrowly ovate to broadly oblong, 6-10 cm long, base rounded to cuneate or cordate, margins sharply doubly toothed, apex acuminate, usually softly hairy beneath along major veins and in vein axils, often with scattered, minute, resinous glands. Male (pollen) and female (seed) flowers are in catkins, borne separately, but on the same tree. Seed catkins are erect, ovoid, 1.5-3 cm long, generally remaining intact after release of fruits in late fall, scales 3-lobed, sparsely to moderately hairy; pollen catkins elongate and hanging. Seeds (nutlets) have wings narrower than body. The common name pertains to the yellow color of the bark and fall leaves.

Variation within the species. Two varieties have been recognized (see Fernald 1950; Braun 1961); var. macrolepis differs from typical variety alleghaniensis in its larger fruiting catkin scales (8-13 mm long vs. 5-8 mm), with more elongated basal portion. Erdmann (1990) and Furlow (1993) regard the species as variable but without formally recognized varieties.

Yellow birch is closely similar to cherry birch (Betula lenta). Cherry birch differs in its light grayish brown bark that remains close (vs. dark, freely exfoliating bark), leaves with fine, sharp teeth (vs. coarse teeth), and catkin scales without hairs (vs. hairy scales). The twigs and inner bark of cherry birch have a stronger wintergreen odor. Yellow birch forms natural hybrids with paper birch (B. papyrifera) and with bog birch (B. pumila).

Public Domain

USDA NRCS National Plant Data Center & Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The range of yellow birch extends from southern Newfoundland, Cape
Breton Island, Nova Scotia, New Brunswick, Anticosti Island, the Gaspe
peninsula, and Maine west to southern and southwestern Ontario and
Minnesota; south to northern New Jersey, northern Ohio, extreme northern
Indiana and Illinois; and south in the mountains to South Carolina,
extreme northeastern Georgia, and eastern Tennessee [76].
  • 76. Little, Elbert L., Jr. 1979. Checklist of United States trees (native and naturalized). Agric. Handb. 541. Washington, DC: U.S. Department of Agriculture, Forest Service. 375 p. [2952]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

The native Yellow Birch is rare in Illinois, where it is restricted to the northern section of the state (see Distribution Map). It is state-listed as 'endangered.' Illinois lies along the southwestern range-limit of this tree, which prefers a cool moist boreal climate. Habitats consist of protected areas of bluffs, north-facing wooded slopes, and ravines where either mixed or hardwood forests occur. Because of its thin bark and poor resprouting capability, this tree is easily killed by wildfires.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

CT GA IN IL IA KY ME MD MA MI
MN NH NJ NY NC OH PA RI SC TN
VT VA WV WI NB NF NS ON PQ

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yellow birch ranges from Newfoundland, Nova  Scotia, New Brunswick, and Anticosti Island west through southern  Ontario to extreme southeastern Manitoba; south to Minnesota and  northeastern Iowa; east to northern Illinois, Ohio, Pennsylvania  to northern New Jersey and New England; and south in the  Appalachian Mountains to eastern Tennessee and northeastern  Georgia. Southward yellow birch grows at higher elevations,  appears more sporadically, and finally is restricted to moist  gorges above 914 m (3,000 ft).

    The largest concentrations of yellow birch timber  are found in Quebec, Ontario, Maine, Upper Michigan, New York,  and New Brunswick (96). About 50 percent of the growing stock  volume of yellow birch in North America is in Quebec.

   
  -The native range of yellow birch.


  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

G. G. Erdmann

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Betula lutea var. macrolepis Fernald:
Canada (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Betula alleghaniensis Britton:
Canada (North America)
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Betula lutea F. Michx.:
Canada (North America)
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

St. Pierre and Miquelon; N.B., Nfld., N.S., Ont., P.E.I., Que.; Ala., Conn., Ga., Ill., Ind., Iowa, Ky., Maine, Md., Mass., Mich., Minn., N.H., N.J., N.Y., N.C., Ohio, Pa., R.I., S.C., Tenn., Vt., Va., W.Va., Wis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

United States

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yellow birch ranges from Newfoundland, Nova Scotia, New Brunswick, and Anticosti Island west through southern Ontario to extreme southeastern Manitoba; south to Minnesota and northeastern Iowa; east to northern Illinois, Ohio, Pennsylvania to northern New Jersey and New England; and south in the Appalachian Mountains to eastern Tennessee and northeastern Georgia. For current distribution, please consult the Plant Profile page for this species on the PLANTS Web site.

Public Domain

USDA NRCS National Plant Data Center & Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Description

More info for the terms: monoecious, tree

Yellow birch is a native, deciduous tree. It usually ranges from 60 to
75 feet (18-23 m) in height and up to 2 feet (0.6 m) in diameter, and
occasionally grows to 100 feet (30 m) in height and 4 feet (1.2 m) in
diameter [14,44,53]. Open-grown yellow birch crowns are long and wide
spreading; in more dense forest crowns are short and irregularly rounded
[53]. The trunk usually divides into a few spreading branches but
lateral shade produces a straight trunk that extends nearly to the top
of the tree. In dense stands the trunk is free of branches for over
half the height of the tree [53]. The bark is somewhat lustrous,
separating in thin layers [14] which exfoliate and result in a finely
shaggy appearance [44]. On old trunks, the bark is deeply grooved and
about 0.5-inch (1.2-cm) thick [25]. The root system of yellow birch is
generally shallow but variable. There is a well-developed extensive
lateral root system; roots spread horizontally or may penetrate more
than 5 feet (1.5 m). Yellow birch is monoecious [32]. The fruit is a
winged nutlet 0.13- to 0.14-inch (3.2-3.5-mm) long (not including
the wings) [14].

Yellow birch is slow growing [32]. Average longevity is approximately
150 years, but maximum longevity is over 300 years [58].
  • 14. Brown, Russell G.; Brown, Melvin L. 1972. Woody plants of Maryland. Baltimore, MD: Port City Press. 347 p. [21844]
  • 25. Collingwood, G. H.; Brush, Warren D.; [revised and edited by Butcher, Devereux]
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 44. Gleason, Henry A.; Cronquist, Arthur. 1991. Manual of vascular plants of northeastern United States and adjacent Canada. 2nd ed. New York: New York Botanical Garden. 910 p. [20329]
  • 53. Hosie, R. C. 1969. Native trees of Canada. 7th ed. Ottawa, ON: Canadian Forestry Service, Department of Fisheries and Forestry. 380 p. [3375]
  • 58. Houle, Gilles; Payette, Serge. 1990. Seed dynamics of Betula alleghaniensis in a deciduous forest of northeastern North America. Journal of Ecology. 78: 677-690. [13325]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Trees , to 30 m; trunks straight, crowns narrowly round. Bark of young trunks and branches dark reddish brown, in maturity tan, yellowish, or grayish, lustrous, smooth, irregularly exfoliating, or sometimes darkening and remaining close; lenticels dark, horizontally expanded. Twigs with odor and taste of wintergreen when crushed, glabrous to sparsely pubescent, usually covered with small resinous glands. Leaf blade narrowly ovate to ovate-oblong with (9--)12--18 pairs of lateral veins, 6--10 × 3--5.5 cm, base rounded to cuneate or cordate, margins sharply doubly serrate, teeth coarse, rather irregular, apex acuminate; surfaces abaxially usually moderately pubescent, especially along major veins and in vein axils, often with scattered, minute, resinous glands. Infructescences erect, ovoid, 1.5--3 × 1--2.5 cm, generally remaining intact after release of fruits in late fall; scales sparsely to moderately pubescent, lobes diverging proximal to middle, central lobe tapering to narrow tip, lateral lobes ascending or partially extended, broader, rounded. Samaras with wings narrower than body, broadest near summit, not or only slightly extended beyond body apically. 2 n = 84.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Synonym

Betula alleghaniensis var. fallax (Fassett) Brayshaw; B. alleghaniensis var. macrolepis (Fernald) Brayshaw; B. lutea F. Michaux; B. lutea var. macrolepis Fernald
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Isotype for Betula alleghaniensis Britton
Catalog Number: US 331258
Collection: Smithsonian Institution, National Museum of Natural History, Department of Botany
Verification Degree: Original publication and alleged type specimen examined
Preparation: Pressed specimen
Collector(s): ex herb. Biltmore
Year Collected: 1897
Locality: Upper slopes of Mt. Pisgah., North Carolina, United States, North America
  • Isotype: Britton, N. L. 1904. Bull. Torrey Bot. Club. 31: 166.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Botany

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Key Plant Community Associations

More info for the terms: codominant, natural, shrubs

Yellow birch is usually found singly or in small groups [32], growing
with American beech (Fagus grandifolia), maples (Acer spp.),
particularly sugar maple (A. saccharum), ashes (Fraxinus spp.), aspens
(Populus spp.), other birches (Betula spp.), eastern white pine (Pinus
strobus), red spruce (Picea rubens), and balsam fir (Abies balsamea)
[25]. In the Great Lakes-St. Lawrence forest region, yellow birch
occurs in mixed forests with red pine (P. resinosa) and eastern white
pine, and with eastern hemlock (Tsuga canadensis) [1]. Yellow birch is
a dominant, codominant, or important species in northern hardwoods-red
spruce forest, northern hardwoods, transition hardwoods-eastern white
pine, and in central hardwoods-eastern hemlock-eastern white pine [28].
Yellow birch is codominant with yellow buckeye (Aesculus octandra) in
western Great Smoky Mountains National Park [19]. In the Catskill
Mountains of New York, yellow birch is dominant in some spruce-fir
stands and codominant in most others. It occurs as nearly pure stands
on steep slopes at higher altitudes, or mixed with black cherry (Prunus
serotina), mountain maple (Acer spicatum), red maple (A. rubrum) and
paper birch (B. papyrifera) in open, scrubby stands on ridgetops [86].

Small trees and shrubs associated with yellow birch include sweet birch
(B. lenta), ironwood (Ostrya virginiana), American hornbeam
(Carpinus caroliniana), striped maple (A. pensylvanicum), mountain
maple, alternate-leaved dogwood (Cornus alternifolia), beaked hazelnut
(Corylus cornuta), Atlantic leatherwood (Dirca palustris), witch-hazel
(Hamamelis virginiana), American fly honeysuckle (Lonicera canadensis),
American mountain-ash (Sorbus americana), Canada elderberry (Sambucus
canadensis), Canada yew (Taxus canadensis), and mapleleaf viburnum
(Viburnum acerifolium) [32].

The largest concentrations of yellow birch are found in Quebec, Ontario, New
Brunswick, Maine, upper Michigan, and New York. About 50 percent of the
growing stock volume of yellow birch is in Quebec [32].

Publications listing yellow birch as a dominant or codominant species in
vegetation classification schemes include:

The natural forests of Maryland: an explanation of the vegetation map of
Maryland [15]
Field guide: Habitat classification system for Upper Peninsula of
Michigan and northeast Wisconsin [24]
White Mountain landscapes [36]
A forest classification for the Maritime Provinces [79]
A classification of the deciduous forest of eastern North America [88]
Vegetation-environment relations in virgin, middle elevation forests
in the Adirondack Mountains, New York [101]
Vegetation of the Great Smoky Mountains [123]
Classification of forest ecosystems in Michigan [126]
  • 1. A. D. Revill Associates. 1978. Ecological eff. of fire and its mgmt. in Canada's national parks: a synthesis of the literature. Vols 1&2. Lit. Rev. & Annot. Bibliography. Ottawa, ON: Parks Canada, National Parks Branch, Natural Resources Division. 345 p. [3416]
  • 15. Brush, Grace S.; Lenk, Cecilia; Smith, Joanne. 1980. The natural forests of Maryland: an explanation of the vegetation map of Maryland. Ecological Monographs. 50(1): 77-92. [19035]
  • 19. Callaway, Ragan M.; Clebsch, Edward E. C.; White, Peter S. 1987. A multivariate analysis of forest communities in the western Great Smoky Mountains National Park. American Midland Naturalist. 118(1): 107-120. [15604]
  • 24. Coffman, Michael S.; Alyanak, Edward; Resovsky, Richard. 1980. Field guide habitat classification system: For Upper Peninsula of Michigan and northeast Wisconsin. [Place of publication unknown]
  • 25. Collingwood, G. H.; Brush, Warren D.; [revised and edited by Butcher, Devereux]
  • 28. DeGraaf, Richard M.; Yamasaki, Mariko; Leak, William B.; Lanier, John W. 1992. New England wildlife: management of forested habitats. Gen. Tech. Rep. NE-144. Radnor, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 271 p. [19322]
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 36. Fay, Stephen C.; Alvis, Richard. 1993. White Mountain landscapes. Laconia, NH: U.S. Department of Agriculture, Forest Service, Region 9, White Mountain National Forest. 76 p. Working draft. [21663]
  • 79. Loucks, O. L. 1959. A forest classification for the Maritime Provinces. Proceedings, Nova Scotian Institute on Science. 25: 86-167. [15408]
  • 86. McIntosh, R. P.; Hurley, R. T. 1964. The spruce-fir forest of the Catskill Mountains. Ecology. 45(2): 314-326. [14886]
  • 88. Monk, Carl D.; Imm, Donald W.; Potter, Robert L.; Parker, Geoffrey G. 1989. A classification of the deciduous forest of eastern North America. Vegetatio. 80: 167-181. [9297]
  • 101. Roman, John Ross. 1980. Vegetation-environment relationships in virgin, middle elevation forests in the Adirondack Mountains, New York. Syracuse, NY: State University of New York. PhD. Dissertation. Dissertation Abstracts International. 41(3): 807-B. [21154]
  • 123. Whittaker, R. H. 1956. Vegetation of the Great Smoky Mountains. Ecological Monographs. 26(1): 1-79. [11108]
  • 126. Pregitzer, Kurt S.; Ramm, Carl W. 1984. Classification of forest ecosystems in Michigan. In: Bockheim, James G., ed. Forest land classification: experiences, problems, perspectives: Proceedings of a symposium; 1984 March 18-20; Madison, WI. Madison, WI: University of Wisconsin, Department of Soil Science: 114-131. [12779]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

5 Balsam fir
16 Aspen
17 Pin cherry
18 Paper birch
19 Gray birch - red maple
20 White pine - northern red oak - red maple
21 Eastern white pine
22 White pine - hemlock
23 Eastern hemlock
24 Hemlock - yellow birch
25 Sugar maple - beech - yellow birch
26 Sugar maple - basswood
27 Sugar maple
28 Black cherry - maple
30 Red spruce - yellow birch
31 Red spruce - sugar maple - beech
32 Red spruce
33 Red spruce - balsam fir
34 Red spruce - Fraser fir
35 Paper birch - red spruce - balsam fir
37 Northern white-cedar
39 Black ash - American elm - red maple
50 Black locust
57 Yellow-poplar
58 Yellow-poplar - eastern hemlock
59 Yellow-poplar - white oak - northern red oak
60 Beech - sugar maple
107 White spruce
108 Red maple

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

K093 Great Lakes spruce - fir forest
K096 Northeastern spruce - fir forest
K097 Southeastern spruce - fir forest
K102 Beech - maple forest
K106 Northern hardwoods
K107 Northern hardwoods - fir forest
K108 Northern hardwoods - spruce forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat characteristics

Soils: Yellow birch occurs on moist, well-drained soils of uplands and
mountain ravines [32]. It occurs on various soil types including
glacial tills, outwash sands, lacustrine deposits, shallow loess, and
residual soils derived from sandstone, limestone, igneous, and
metamorphic rock [32]. In the Adirondacks, yellow birch occurs on soils
derived from limestone, gneiss, anorthosite, sandstones, shales, and
conglomerates [67]. The best growth occurs on well-drained fertile
loams and moderately well-drained sandy loams [32]. Even though growth
is poor, yellow birch is often abundant where drainage is restricted.
Yellow birch occurs on muck soils with pH 7.5 to 8.0 [9]. In New York,
yellow birch occurred on wetland soils with soil surface pH ranging from
4.0 to 6.8 [59]. Birches (Betula spp.) are sensitive to soil phosphorus
[90].

Periodic droughts are damaging to yellow birch because of its shallow
roots [55].

Elevation: In the Adirondacks and the Appalachians, yellow birch
reaches its maximum importance in the transition zone between low
elevation deciduous forest and montane spruce-fir forests. In the
Adirondacks, it occurs at elevations ranging from 100 feet (30 m) to
3,413 feet (1040 m), but is uncommon above 3,000 feet (914 m)
[10,39,61,67]. The lower slopes to about 2,310 feet (700 m) are
dominated by sugar maple, American beech, and yellow birch. Between
2,310 feet and 2,970 feet (700-900 m) is a transition zone to spruce and
spruce-fir forests. In the southern Appalachians the highest importance
value for yellow birch occurs at mid- to high-elevations from 2,800 to
3,000 feet (853-914 m) [19,23]. In western Great Smoky Mountains
National Park, yellow birch tends to be more concentrated in protected
coves at lower elevations, and spreads out of the coves at higher
elevations [19].
  • 9. Barnes, Burton V. 1976. Succession in deciduous swamp communities of southeastern Michigan formerly dominated by American elm. Canadian Journal of Botany. 54: 19-24. [4914]
  • 10. Battles, John J.; Johnson, Arthur H.; Siccama, Thomas G.; [and others]
  • 19. Callaway, Ragan M.; Clebsch, Edward E. C.; White, Peter S. 1987. A multivariate analysis of forest communities in the western Great Smoky Mountains National Park. American Midland Naturalist. 118(1): 107-120. [15604]
  • 23. Cogbill, C. V.; White, P. S. 1991. The latitude-elevation relationship for spruce-fir forest and treeline along the Appalachian mountain chain. Vegetatio. 94(2): 153-175. [16806]
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 39. Fitzgerald, Brian T.; Raynal, Dudley J. 1991. Population dynamics and growth of balsam fir on Whiteface Mountain, New York. Bulletin of the Torrey Botanical Club. 118(3): 255-264. [16764]
  • 55. Hough, A. F.; Forbes, R. D. 1943. The ecology and silvics of forests in the high plateaus of Pennsylvania. Ecological Monographs. 13(3): 299-320. [8723]
  • 59. Huenneke, Laura Foster. 1982. Wetland forests of Tompkins County, New York. Bulletin of the Torrey Botanical Club. 109(1): 51-63. [22960]
  • 61. Johnson, Arthur H.; McLaughlin, Samuel B. 1986. The nature and timing of the deterioration of red spruce in the northern Appalachian Mountains. In: Acid deposition: long term trends. [Place of publication unknown]
  • 67. Kudish, Michael. 1992. Adirondack upland flora: an ecological perspective. Saranac, NY: The Chauncy Press. 320 p. [19376]
  • 90. Perala, Donald Albert. 1987. Regenerating the birches: ecology and cultural requirements. St. Paul, MI: University of Minnesota. 215 p. Thesis. [12115]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White - red - jack pine
FRES11 Spruce - fir
FRES15 Oak - hickory
FRES16 Oak - gum - cypress
FRES17 Elm - ash - cottonwood
FRES18 Maple - beech - birch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

The native Yellow Birch is rare in Illinois, where it is restricted to the northern section of the state (see Distribution Map). It is state-listed as 'endangered.' Illinois lies along the southwestern range-limit of this tree, which prefers a cool moist boreal climate. Habitats consist of protected areas of bluffs, north-facing wooded slopes, and ravines where either mixed or hardwood forests occur. Because of its thin bark and poor resprouting capability, this tree is easily killed by wildfires.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Soils and Topography

Yellow birch grows over a large area with  diverse geology, topography, and soil and moisture conditions. In  Michigan and Wisconsin it is found on glacial tills, outwash  sands, lacustrine deposits, shallow loess deposits, and residual  soils derived from sandstone, limestone, and igneous and  metamorphic rock (95). Soils are also derived from granites,  schists, and shales in other parts of its range.

    Growth of yellow birch is affected by soil  texture, drainage, rooting depth, stone content in the rooting  zone, elevation, aspect, and fertility. Yellow birch grows best  on well-drained, fertile loams and moderately well-drained sandy  loams within the soil orders Spodosols and Inceptisols and on  flats and lower slopes (45). It also grows on Alfisols typical of  the humid temperature forest region. Rootlet development is  profuse in loam but poor in sand. Even though its growth is poor,  yellow birch is often abundant where drainage is restricted  because competition from other species is less severe.

    In the Lake States birch grows best on well- and  moderately well-drained soils and on lacustrine soils capped with  loess. Its growth is poor on poorly-drained lacustrine soils,  shallow soils over limestone, and coarse-textured sandy loams  without profile development (95). Site quality between the best  and poorest sites differs by more than 9 m (30 ft) at 50 years.

    In the Green Mountains of Vermont birch grows on  unstratified glacial till up to 792 m (2,600 ft) (109). Here,  thickness of the upper soil horizon as influenced by elevation  and aspect have been used to estimate site index-birch grows  better at lower elevations than higher elevations and on  northeast aspects than southwest aspects.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

G. G. Erdmann

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Climate

Yellow birch grows in cool areas with  abundant precipitation. Its northern limit coincides with the 2°  C (35° F) average annual temperature isotherm, and its  southern and western limits coincide with the 30° C (86°  F) maximum temperature isotherm (31). Although the average annual  temperature is about 7° C (45° F) throughout its range,  temperature extremes range from -40° C to 38° C (-40°  F to 100° F) (45). Annual precipitation rtinges from about  1270 mm (50 in) in the East to 640 mm (25 in) in central  Minnesota at its western limit. More than half of the  precipitation may be snow. Snowfall ranges from 152 to 356 cm (60  to 140 in) and averages 229 cm (90 in) in the north. The growing  season ranges from 60 to 150 days and averages about 120 days.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

G. G. Erdmann

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stream banks, swampy woods, and rich, moist, forested slopes; 0--500m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Establishment

Adaptation: Yellow birch is a characteristic tree of the northern Appalachians and the hemlock hardwoods forest of the Great Lakes region, at elevations of mostly 0-500 meters but up to 1050 meters. In the Appalachians and the Adirondacks, yellow birch reaches its maximum importance in the transition zone between low elevation deciduous forest and montane spruce-fir forests. Yellow birch occurs on moist, well-drained soils of various types of uplands and mountain ravines and along stream banks and in swampy woods. It may also grow where drainage is restricted, but growth may be correspondingly poor. Flowering: April-May, beginning before leafing; fruiting: July-August.

General: Yellow birch reproduces primarily by seed, normally first at about 40 years but optimally at about 70 years – trees under 20 years sometimes produce seed. Good seed crops are produced at intervals of 1-4 years, usually with little seed produced in intervening years. Viability under natural conditions decreases around the second year.

Seeds germinate and grow best on moist mineral soil enriched with humus, but those in undisturbed stands usually germinate on mossy logs, decayed wood, in cracks in boulders, and on wind thrown tree hummocks. Seedlings cannot pierce compacted hardwood litter. Scarification of seedbeds improves seedling establishment, but organic matter should be left mixed in with the mineral soil. Seed dormancy is broken (under artificial conditions) by stratification or by exposure of wet seed to cool-white fluorescent light. Seeds can be stored 2-4 years or longer without losing viability.

Gap conditions are conducive to yellow birch seedling establishment, and seedling survival is better on disturbed microsites. Mortality of seedlings is usually very high. Seedlings surviving their first year survive to sapling and larger stages only where there is sufficient light, although some shade improves seedling survival.

Yellow birch has been termed “a persistent successional species.” Its presence in mid- to late-successional stands depends on local disturbance; it cannot reproduce under a closed canopy and requires soil disturbance and light for seedling survival. Older trees do not sprout. In northern hardwood ecosystems, yellow birch reaches maximum importance levels within 15 years of disturbance, and those levels are maintained for at least 100 years. In many old-growth stands, yellow birch usually decreases in importance as the stand ages, but the species is often a component of old growth types and sometimes occurs as a major component of climax stands, perhaps through a combination of longevity and micro-succession. Yellow birch often reaches 150 years; the average age in old growth woods may be 200-250 years. Maximum age is over 300 years.

Public Domain

USDA NRCS National Plant Data Center & Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Faunal Associations

Various insects feed on the foliage, bore through the wood, suck plant juices, or feed on the seeds of Yellow Birch and other birches (Betula spp.).  These species include caterpillars of the butterfly Nymphalis vau-album j-album (Compton Tortoiseshell) and the caterpillars of such moths as Acronicta betulae (Birch Dagger Moth), Peridea ferruginea (Chocolate Prominent), Venusia comptaria (Brown-Shaded Carpet), and others (see Moth Table). Other insect feeders include Calaphis betulaecolens (Common Birch Aphid) and other aphids, Erythridula praecisa and other leafhoppers, the psyllid Cacopsylla hartigii, Corythucha pallipes (Birch Lace Bug), the plant bugs Lygocoris fagi and Orthotylus necopinus, the stink bug Banasa dimiataKleidocerys resedae (Birch Catkin Bug), the larvae of Agrilus anxius (Bronze Beech Borer) and other wood-boring beetles, the leaf beetles Altica betulae and Calligrapha ignota, the larvae of such sawflies as Arge pectoralis (Birch Sawfly) and Dimorphopteryx melanognathus (Fringed Birch Sawfly), and larvae of Oligotrophus betheli (Birch Seed Midge). See the Insect Table for a more complete listing of these species. Because of the thin bark, the Yellow-Bellied Sapsucker drills holes and feeds on the sap of Yellow Birch. The seeds, catkins, and buds are eaten by such birds as the Ruffed Grouse, Common Redpoll, Black-Capped Chickadee, Purple Finch, White-Winged Crossbill, and Slate-Colored Junco. Among mammals, the Red Squirrel feeds on the seeds, the White-Tailed Deer and Cottontail Rabbit browse on seedlings and saplings, and the Beaver gnaws on the bark and wood. Some vertebrate animals use birches and other trees as a source of cover and reproductive habitat. For example, such species as the Red Bat (Lasiurus borealis), Hoary Bat (Lasiurus cinereus), and Silver-Haired Bat (Lasionycteris noctivagans) use trees for summer roosting sites, maternity colonies, and hibernation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Damaging Agents

Yellow birch is a very sensitive  species that is more susceptible to injury than its common  associates. It is windfirm on deep, well-drained loam and sandy  loam soils but is subject to windthrow on shallow, somewhat  poorly drained soils. Thin-barked yellow birch is susceptible to  fire injury. Seedlings and saplings are killed outright by even  light surface fires. The fine branching habit of yellow birch  makes it susceptible to damage from accumulating ice or snow  loads. Large trees are frost hardy (91) but late spring frost can  kill 10-year-old seedlings, especially on litter seedbeds under  full and partial shade. Winter sunscald can be a problem on the  south and southwest sides of birch boles. Birch foliage and twigs  are injured by wind-borne salt spray. Seed germination is also  greatly reduced by 0.20-percent salt concentrations in the soil  (6). Simulated acid rain at pH values from 3 up to 4 stimulated  birch germination (80) but foliar damage occurs at pH levels of 3  or less and seedling growth reductions at pH 2.3 (127). Yellow  birch seedlings are tolerant to atmospheric pollution of ozone at  0.25 p/m (67) and sensitive to 3.5 p/m of sulfur dioxide (66).

    Post-logging decadence is a localized decline from  which most trees recover. It consists of top dying and some  mortality following heavy cutting in mature and overmature  stands. Yellow birch is more susceptible to root, stem, or crown  injury and more severely affected than its common hardwood  associates. Weakened trees are often attacked and eventually  killed by the bronze birch borer.

    A decline of yellow birch and paper birch trees, called birch  dieback, caused widespread mortality between 1932 and 1955 in  eastern Canada and northeast United States. It affected yellow  birches of all sizes, even in undisturbed virgin stands. The  first visible symptoms of dieback are similar to those of  decadence. Foliage in the upper crown appears small, curled,  cupped, yellowish, and thin. Following this, tips of branches  die, then dying progresses downward, involving entire branches  and often more than half the crown within 2 or 3 years. Trees are  usually killed within 3 to 5 years by the bronze birch borer,  which with root rot fungi, the gold ring spot virus, and other  pests have been considered secondary agents associated with birch  dieback. Many researchers have attributed birch dieback to  adverse climatic conditions, drought, and increased soil  temperature, over an extended period, which caused rootlet  mortality that weakened the trees and predisposed them to attacks  by the borer. Others have considered over-maturity, past cutting  practices, killing of associated trees by disease and the spruce  budworm, and defoliating insect outbreaks on birch as initially  responsible for weakening the trees. More recently the apple  mosaic virus (49) and the "frozen soil" theory (59)  have been suggested as the possible triggering mechanisms for  birch dieback. Under the "frozen soil" theory,  shallow-rooted birch trees in years without snow cover are  apparently unable to replace moisture losses from their stems  through both frozen rootlets and those broken from frost heaving.  To date, no single "triggering" cause of birch dieback  has been widely accepted, but the condition is probably the  result of one or more of the indicated stress factors.

    Top-dying and reduced growth of yellow birch  crowns have also been associated with heavy birch seed crops  (51). This dieback occurs the year after bumper seed crops and is  limited to the peripheral 0.6 to 0.9 m (2 to 3 ft) of branch tips  on mature trees and usually just the past season's growth on  younger trees.

    Discoloration and decay are the major causes of  defect and loss in wood quality of yellow birch (75,92).  Discoloration and decay develop more rapidly in yellow birch than  other diffuse-porous northern hardwood species (60,107). Some of  the nonhymenomycetes most frequently isolated from discolored  wood associated with birch wounds are Libertella betulinaTrichocladium canadense, Phialophora spp., Phialocephala spp.,  Hypoxylon spp., and Nectria spp. (32,103,104,107).

    Mechanical wounds with more than 320  cm² (50 in²) of  exposed wood are important entrance courts for decay fungi (92).  Pholiota limonella, P. aurivella, Polyporus versicolorDaldinia concentrica, and Hypoxylon spp. are  aggressive invaders of these larger wounds (76,104,106). D.  concentrica and Hypoxylon spp. also invade branch  stubs. Extensive decay is usually associated with larger  mechanical injuries more than 20 years old and frost cracks more  than 10 years old. Species of Phialophora are often found  in tissues near frost cracks (33). Bacteria, Graphium spp.,  Phialophora spp., Polyporus spp., Pholiota spp., and Nectria  are the microorganisms most frequently associated with  increment-bore wounds in birch (60). Increment-bore wounds cause  reddish-brown decay columns from 74 to 213 cm (29 to 84 in) long  within 2 years following boring.

    Nectria galligena is the most common and damaging stem  disease of yellow birch. It causes perennial targetlike cankers,  a twig blight, and subsequent crown dieback (59). The fungus can  penetrate saplings, small branches, buds, and wounds but usually  enters the host through cracks originating at branch axils from  heavy snow or ice loads (7). Nectria cankers cause  localized defects that reduce stem quality and weaken the stem,  increasing the chances for wind breakage (45).

    Diaporthe alleghaniensis causes a black sunken canker and  shoot blight of yellow birch (1). Natural infections probably  enter through bud scale scars, frost cracks, leaf scars, wounds,  and other injuries (2). Cankers appear on shoots, stems, and  petioles of seedlings in the spring and summer and foliage wilts  and browns in the summer. Outbreaks of D. alleghaniensis occur  only when conditions are optimum for infection and growth (70).  Normally the fungus is weakly pathogenic and thins out less  vigorous and overtopped seedlings.

    Gnomonia setacea causes a canker, shoot blight, and leaf  spot disease of yellow birch seedlings (71).

    Stereum murrayi causes elongated, sunken, bark-covered  stem cankers and a yellow-brown stringy trunk rot of yellow  birch. Cankers are common on branch stubs and decay usually  extends about 0.3 m (1 ft) above and below cankers on pole-sized  trees (106). Decay can be extensive in overmature yellow birch.  Phellinus laevigatus also produces characteristic sunken,  bark-covered cankers on mature and over-mature trees. Single  cankers indicate extensive decay. It is more common on dead than  living trees. Inonotus obliquus produces black,  clinker-like, sterile conks that develop in trunk wounds and  branch stubs. Sometimes conks of L. obliquus and  Phellinus igniarius occur on dead branch stubs in the  center of Nectria cankers. A sterile conk indicates from 50 to  100 percent cull (59) and decay extends from 1.5 to 2.1 m (5 to 7  ft) above and below each conk. Inonotus obliquus is an  aggressive decay fungi that can invade and kill tissues around  these sterile conks (106).

    Armillaria mellea, the shoestring root rot, is the most  common and important root and butt decayer of yellow birch trees  (106). The fungus causes a white root rot with black rhizomorphs  on the roots.

    Inonotus obliquus, Pholiota spp., Phellinus igniarius,  and P. laevigata are the principal decay fungi of yellow  birch trunks (45,76,106). The false tinder fungus (P.  igniarius) causes a common white trunk rot of yellow  birch. A single conk indicates extensive decay that extends 2.4  to 3.0 m (8 to 10 ft) above and below the conk. Pholiota  aurivella is an aggressive decayer of centers of larger  birches and Pholiota limonella causes a yellow-brown  stringy trunk rot.

    Ganoderma applanatum usually occurs on dead birches but  sometimes rots the centers of trunks and infects roots and butts  through wounds (106). Perennial, hoof-shaped conks of Fomes  fomentarius, the tinder fungus, are common on dead birch. The  fungus also has been associated with decay in living and dead  branches of dieback birches. Piptoporus betulinus, Fomitopsis  pinicola, and Polyporus lucidus also are primarily  decayers of dead wood but they may extend into centers of living  trees (59).

    Coniothyrium spp., common twig-inhabiting fungi, injure  yellow birch seeds and seedlings (108). They are associated with  weevils that tunnel through the cones and destroy or injure the  seeds.

    The bronze birch borer (Agrilus anxius) is  the most serious insect pest of yellow birch. It attacks both  healthy and weakened birches (83) but apparently can normally  complete its life cycle only in dead or dying wood in weakened  trees. Mature and overmature trees left severely exposed after  logging and in lightly stocked stands are more subject to attack  then trees in well-stocked stands. Adults deposit their eggs in  bark crevices of upper branches. Grubs hatch, bore meandering  tunnels underneath the bark that cause top dying, then move  progressively lower down the stem and kill the tree within 2 or 3  years. The Columbian timber beetle (Corthylus columbianusbores deep into the sapwood of vigorous birches of all sizes  (3). A flatheaded borer (Chrysobothris sexsignata) occurs  commonly on birch in the East. The ambrosia beetle (Xyloterinus  politus) is a secondary insect that attacks weakened and  wounded birches. Adults bore holes through lenticles in the bark  and make galleries (105).

    In outbreaks, the birch skeletonizer (Bucculatrix  canadensisella) completely destroys foliage by August.  Successive attacks reduce host vigor and may predispose birches  to bronze birch borer attacks.

    Although yellow birch is not a preferred host of  the forest tent caterpillar (Malacosoma disstria), the  gypsy moth (Lymantria dispar), the elm spanworm (Ennomos  subsignarius), the hemlock looper (Lambdina fiscellaria),  or the saddled prominent (Heterocampa guttivitta), caterpillars  of these species defoliate birch in severe outbreaks. Two to  three years of successive defoliation can kill birch trees (122).  Dusky birch sawfly larvae (Croesus latitarsus) prefer  small saplings of gray birch but also defoliate yellow birch  saplings by feeding inward along leaf edges (3). The lace bug,  Corythucha pallipes, can be a very injurious insect,  especially on young birch (25). A treehopper (Carynota  stupida), a stink bug (Elasmuche lateralis), an aphid  (Euceraphis betulae), a lygaeid bug (Kleidocerys  resedae germinatus), and a scale insect (Xylococculus  betulae) are other commonly to abundantly occurring  sucking insects of yellow birch (3). E. lateralis and  Kleidocerys resedae germinatus also feed on catkins. The  birch seed midge (Oligotrophus betheli) lives in birch  seed and makes it infertile.

    Yellow birch is a preferred food of the snowshoe  hare and the white-tailed deer. White-tails are especially fond  of browsing seedlings during the summer, and green leaves and  woody stems in the fall, and they favor succulent sprouts over  slower growing seedlings. Heavy or repeated browsing often kills  seedlings. Moose often severely browse it. Porcupine feeding  often damages birch crowns, reduces wood quality, and sometimes  kills the trees. Red squirrels cut new germinants, eat seeds,  store mature strobiles, and feed on birch sap.

    Yellow birch is a favorite summer food source of  the yellow-bellied sapsucker on its nesting grounds. Heavy  sapsucker feeding can reduce growth, lower wood quality, or even  kill birch. The common redpoll and many other songbirds eat  yellow birch seed. Ruffed grouse feed on the catkins, seeds, and  buds.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

G. G. Erdmann

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Fire Management Considerations

More info for the term: litter

Regression coefficients relating bark thickness to diameter at breast height
have been published for yellow birch [51].

The moisture content of the inner bark of yellow birch ranges from 44 to
65 percent, depending on season of sampling. The heat of combustion
of dry yellow birch bark is 9,200 Btu [129].

Site Preparation: Fire has been used to create suitable seedbed
conditions for yellow birch regeneration [1]. In New York, the number
of yellow birch seedlings was higher on postharvest plots that had been
prescribed burned and scarified than on plots that had either been
prescribed burned or scarified, or on control plots [11]. Prescribed
fires have been used for yellow birch seedbed preparation in Ontario.
The fires were conducted in late fall, after sugar maple and beech leaf
and seedfall and before the major portion of yellow birch seeds were
dispersed. Low-intensity surface fires consumed litter and killed
advance regeneration of sugar maple. These fires did not significantly
reduce the number of stems (all species) greater than 0.6 inch (1.5 cm)
d.b.h., though basal scarring was evident. Fire-prepared plots resulted
in higher stocking of yellow birch than unburned plots, and reduced the
development of sugar maple [6,16].
  • 1. A. D. Revill Associates. 1978. Ecological eff. of fire and its mgmt. in Canada's national parks: a synthesis of the literature. Vols 1&2. Lit. Rev. & Annot. Bibliography. Ottawa, ON: Parks Canada, National Parks Branch, Natural Resources Division. 345 p. [3416]
  • 6. Anderson, H. W. 1982. Regenerating yellow birch with prescribed fire. In: Proceedings, Society of American Foresters national convention; 1982 September 19-22; Cincinnati, OH. Bethesda, MD: Society of American Foresters: 168-172. [6715]
  • 11. Behrend, Donald F.; Patric, Earl F. 1969. Influence of site disturbance and removal of shade on regeneration of deer browse. Journal of Wildlife Management. 33(2): 394-398. [15619]
  • 16. Burton, D. H.; Anderson, H. W.; Riley, L. F. 1969. Natural regeneration of yellow birch in Canada. In: The birch symposium: Proceedings; 1969 August 19-21; Durham, NH. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 55-73. [21870]
  • 51. Harmon, Mark E. 1984. Survival of trees after low-intensity surface fires in Great Smoky Mountains National Park. Ecology. 65(3): 796-802. [10997]
  • 129. Spalt, Karl W.; Reifsnyder, William E. 1962. Bark characteristics and fire resistance: a literature survey. Occas. Paper 193. New Orleans, LA: U.S. Department of Agriculture, Forest Service, Southern Forest Experiment Station. 19 p. In cooperation with: Yale University, School of Forestry. [266]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plant Response to Fire

More info for the terms: density, hardwood, surface fire, top-kill

Yellow birch is a poor sprouter following top-kill by fire. Seed
germination and seedling establishment are enhanced by fire disturbance.
Yellow birch frequently forms pure patches following fire. In Wisconsin
northern hardwood forests it often comprises 60 percent of the hardwood
thickets [80]. Most of the research on yellow birch regeneration is
associated with logging regimes, so it is not clear what role fire plays
in yellow birch regeneration in unmanaged stands. It is likely that a
low-intensity, patchy fire would create conditions that favor yellow
birch regeneration by reducing the hardwood leaf mat and exposing
mineral soil, but leaving mature trees as a seed source [1].

In northern hardwood forests, postfire regeneration is likely to include
at least a small proportion of yellow birch. Major postfire species in
this area are paper birch, gray birch (Betula populifolia), aspens, red
spruce, and pines (Pinus spp.) [32,89]. In the Laurentian Highlands of
central Quebec, yellow birch is present in low numbers in early postfire
succession on well-drained sites in montane mixed forests. The main
colonizers are balsam fir and paper birch [22]. In North Carolina
spruce-fir forests, which rarely burn, yellow birch was important in
postfire regeneration [103]. Gibson [42] reported that former Atlantic
white-cedar (Chamaecyparis thyoides) swamps developed into red maple or
red maple-yellow birch stands following fire. In northwestern
Pennsylvania, a ridge that supported a dense stand of eastern hemlock
and mixed hardwoods was converted by fire to a stand composed of red
maple, black cherry, yellow birch, and water birch (B. occidentalis) [54].

In northern hardwood types in Wisconsin, low-severity surface fires seem
to favor sugar maple over yellow birch and beech. Severe fires,
however, destroy existing sugar maple reproduction and create openings
in the canopy, favoring yellow birch. The composition of a northern
hardwood stand was traced to three distinct fires, each of which was
followed by an increase in the proportion of yellow birch [80]. Birches
(yellow birch, sweet birch, and paper birch) exhibited a pulse of
reproduction after a surface fire in Connecticut, peaking in density
around 25 years. By 55 years after the fire birch density on burned and
unburned stands was similarly low [117].
  • 1. A. D. Revill Associates. 1978. Ecological eff. of fire and its mgmt. in Canada's national parks: a synthesis of the literature. Vols 1&2. Lit. Rev. & Annot. Bibliography. Ottawa, ON: Parks Canada, National Parks Branch, Natural Resources Division. 345 p. [3416]
  • 22. Cogbill, Charles V. 1985. Dynamics of the boreal forests of the Laurentian Highlands, Canada. Canadian Journal of Forest Research. 15: 252-261. [19928]
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 42. Gibson, J. Miles. 1938. Comments (on article: Fire in modern forest management by Haig, I. T.). Journal of Forestry. 36: 1049-1051. [18566]
  • 54. Hough, A. F. 1936. A climax forest community on East Tionesta Creek in northwestern Pennsylvania. Ecology. 17(1): 9-28. [3460]
  • 80. Maissurow, D. K. 1941. The role of fire in the perpetuation of virgin forests of northern Wisconsin. Journal of Forestry. 39(2): 201-207. [3445]
  • 89. Patterson, William A., III; Saunders, Karen E.; Horton, L. J. 1983. Fire regimes of the coastal Maine forests of Acadia National Park. OSS 83-3. Boston, MA: U.S. Department of the Interior, National Park Service, North Atlantic Region, Office of Scientific Studies. 259 p. In cooperation with: U.S. Department of Agriculture, Forest Service, State and Private Forestry, Broomall, PA. [21108]
  • 103. Saunders, Paul R.; Smathers, Garrett A.; Ramseur, George S. 1983. Secondary succession of a spruce-fir burn in the Plott Balsam Mountains, North Carolina. Castanea. 48(1): 41-47. [8658]
  • 117. Ward, Jeffrey S.; Stephens, George R. 1989. Long-term effects of a 1932 surface fire on stand structure in a Connecticut mixed hardwood forest. In: Rink, George; Budelsky, Carl A., eds. Proceedings, 7th central hardwood conference; 1989 March 5-8; Carbondale, IL. Gen. Tech. Rep. NC-132. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 267-273. [9389]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Immediate Effect of Fire

More info for the terms: presence, resistance, tree

Yellow birch seedlings and saplings are killed by even low-severity
fires [32]. Small trees were killed by fire that left large trees in a
northern hardwoods forest unharmed [105]. Large trees usually survive
fire; Martin [85] mentioned the presence of large, old yellow birch that
predate a fire that initiated a red maple-paper birch stand in Ontario.

A subjective ranking of tree fire resistance compiled by Starker [106]
listed yellow birch as twelfth out of twenty-two species rated.
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 85. Martin, N. D. 1959. An anaylsis of forest succession in Algonquin Park, Ontario. Ecological Monographs. 29(3): 187-218. [19930]
  • 105. Sinclair, G. A. 1962. Progress report of prescribed burning in hardwood stands. Section Report (Forestry) No. 45. Ottawa, ON: Ontario Department of Lands and Forests, Research Branch. 18 p. [25275]
  • 106. Starker, T. J. 1932. Fire resistance of trees of northeast United States. Forest Worker. 8(3): 8-9. [81]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Post-fire Regeneration

More info for the term: root crown

Tree without adventitious-bud root crown
Initial-offsite colonizer (off-site, initial community)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fire Ecology

More info for the terms: fire frequency, fire regime, frequency, fuel, hardwood, mesic, presence, surface fire, tree

Yellow birch is susceptible to fire injury due to its thin bark [32];
young yellow birch do not usually survive fire. Mature trees may
survive because the thin forest floor under large yellow birch does not
usually support severe or persistent surface fire [90]. Yellow birch
germinates readily on early postfire sites [91,92,115].

Forest Type: Heinselman [52] suggested that the presence of yellow
birch in old mixed forests is hard explain without fire disturbance;
however, other authors describe yellow birch as opportunistic with
respect to fire but not fire dependent [90]. Lorimer [77,78] reported
that the presence of yellow birch (in land survey records) is not a
reliable indicator of previous fire. In Massachusetts, a beech-hemlock
forest containing yellow birch developed on an island where fire had not
occurred for many years. The land surrounding the island is occupied by
fire-dependent pitch pine (Pinus rigida) and scrub oak types. In the
1940's the island forest was broken up by a hurricane, which corresponds
with the age of many yellow birch [30].

Fire Frequency: Yellow birch typically occurs in forests with fire-free
intervals of at least 150 to 300 years; the fire regime is characterized
by crown and severe surface fires in combination [52]. The
presettlement hemlock-northern hardwood forests experienced fire
infrequently [2]. In Wisconsin, mesic hemlock-northern hardwood forests
north and east of the transition zone between the fire-dependent
prairie-savanna mosaic and nonfire-dependent forest probably experienced
fire periodically prior to the fire-suppression era. The presence of
large, late-successional species indicates that the average interval
between stand-replacing fires was longer than the average lifespan of
major tree species in the region [20]. In the Great Lakes States and
Acadian Forest region, presettlement northern hardwoods-pine-spruce-fir
forests probably had a semieven-aged structure where less shade-tolerant
components were maintained by long-return interval disturbances such as
fire or windstorms. Most fires in these forests were severe surface
fires, occurring only after prolonged drought, and usually affecting
forests that were breaking up due to other factors (and thus had heavy
fuels). Estimates for Maine presettlement fire return intervals range
from 806 to 1,923 years [77].

In the twentieth century, forest types containing yellow birch in New
Brunswick have either experienced no fires or have had very long
fire-free intervals. For sugar maple-yellow birch-fir in New Brunswick,
the mean annual area burned between 1931 and 1970 was about 0.16 percent
of the total area of that type [119]. A similar study for Nova Scotia
reported that 0.03 percent of the total area (of sugar maple-yellow
birch-fir) burned annually between 1915 and 1975 [120]. In northern
Maine, hardwood forests were estimated to have a fire return interval of
approximately 800 years [2]. Northern hardwood forests had estimated
fire return intervals (from data spanning 1903-1956) of 910 years for
Maine and 770 years for New Hampshire [35].

Fire Season and Conditions: At low elevations in the southern
Appalachians, lightning-caused fires occur less often in the hardwood
forests than in pine-hardwood forests. Fire frequency by forest type is
related to the month of occurrence. Fires that occur before May usually
start at higher elevations; after May, more fires start at lower
elevations and are concentrated in the pine-hardwood type, possibly
because after hardwoods have leafed out fuel moistures are too high to
support fire [8]. In Maine, northern hardwoods are less likely to burn
than other forest types, and are more susceptible to fire damage.
Ignition and spread of fire are unlikely except during the most severe
droughts [89].
  • 2. Abrams, Marc D. 1992. Fire and the development of oak forests. BioScience. 42(5): 346-353. [19215]
  • 8. Barden, Lawrence S.; Woods, Frank W. 1974. Characteristics of lightning fires in southern Appalachian forests. In: Proceedings, annual Tall Timbers fire ecology conference; 1973 March 22-23; Tallahassee, FL. No. 13. Tallahassee, FL: Tall Timbers Research Station: 345-361. [19012]
  • 20. Canham, Charles D.; Loucks, Orie L. 1984. Catastrophic windthrow in the presettlement forests of Wisconsin. Ecology. 65(3): 803-809. [13438]
  • 30. Dunwiddie, Peter W. 1991. Forest history and composition of Halfway Pond Island, Plymouth County, Massachusetts. Rhodora. 93(876): 347-360. [17362]
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 35. Fahey, Timothy J.; Reiners, William A. 1981. Fire in the forests of Maine and New Hampshire. Bulletin of the Torrey Botanical Club. 108: 362-373. [9707]
  • 52. Heinselman, Miron L. 1981. Fire intensity and frequency as factors in the distribution and structure of northern ecosystems. In: Mooney, H. A.; Bonnicksen, T. M.; Christensen, N. L.; [and others]
  • 77. Lorimer, Craig G. 1977. The presettlement forest and natural disturbance cycle of northeastern Maine. Ecology. 58: 139-148. [9711]
  • 78. Lorimer, Craig G. 1980. The use of land survey records in estimating presettlement fire frequency. In: Stokes, Marvin A.; Dieterich, John H., technical coordinators. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 57-62. [16043]
  • 89. Patterson, William A., III; Saunders, Karen E.; Horton, L. J. 1983. Fire regimes of the coastal Maine forests of Acadia National Park. OSS 83-3. Boston, MA: U.S. Department of the Interior, National Park Service, North Atlantic Region, Office of Scientific Studies. 259 p. In cooperation with: U.S. Department of Agriculture, Forest Service, State and Private Forestry, Broomall, PA. [21108]
  • 90. Perala, Donald Albert. 1987. Regenerating the birches: ecology and cultural requirements. St. Paul, MI: University of Minnesota. 215 p. Thesis. [12115]
  • 91. Perala, Donald A.; Alm, Alvin A. 1990. Reproductive ecology of birch: a review. Forest Ecology and Management. 32: 1-38. [12210]
  • 92. Perala, Donald A.; Alm, Alvin A. 1990. Regeneration silviculture of birch: a review. Forest Ecology and Management. 32: 37-77. [12211]
  • 115. Tubbs, Carl H. 1978. Stand composition in relation to uneven-aged silviculture. In: U.S. Department of Agriculture, Forest Service, Timber Management Research, compiler. Uneven-aged silviculture and management in the United States: Proceedings; 1975 July 15-17; 1976 October 19-21; Redding, CA. Gen. Tech. Rep. WO-24. Washington, DC: 88-103. [7318]
  • 119. Wein, Ross W.; Moore, Janice M. 1977. Fire history and rotations in the New Brunswick Acadian Forest. Canadian Journal of Forest Research. 7: 285-294. [17716]
  • 120. Wein, Ross W.; Moore, Janice M. 1979. Fire history and recent fire rotation periods in the Nova Scotia Acadian Forest. Canadian Journal of Forest Research. 9: 166-178. [9705]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Successional Status

More info on this topic.

More info for the terms: climax, density, hardwood, presence, succession, tree

Facultative Seral Species

Yellow birch is intermediate in shade tolerance. Leak [71] assigned
yellow birch to the category of persistent successional species. Yellow
birch is described as opportunistic due to its habit of producing
abundant small seed [40]. Yellow birch seeds comprised a higher than
expected proportion (compared to the abundance of mature trees) of the
seed rain and seedbank of a mixed forest [56]. The presence of yellow
birch in mid- to late-successional stands depends on local disturbance
[28,71]; it cannot reproduce under a closed canopy and requires soil
disturbance and light for seedling survival [32]. Birches respond to
gaps of all sizes, with a peak density found in gaps of about 2,800
square feet (250 sq m) in Pennsylvania. In the southern Appalachians,
birches exhibited a peak density in 10-year-old gaps [102]. In southern
Appalachian spruce-fir forests, yellow birch seedlings were the most
abundant species in gap plots but not in closed-canopy plots. They
exhibited the highest growth rate of any species in gaps [122]. The
origin of the gap is apparently important; in upper Michigan, yellow
birch apparently failed to establish readily in gaps formed by stem
breakage because soil was undisturbed [87]. Yellow birch decreased
between 1964 and 1986 in red spruce-Fraser fir (Abies fraseri) stands,
even though there was loss of the Fraser fir to insect attack [18].

Yellow birch seedlings do not successfully compete with advance
regeneration of other northern hardwood species, grasses, and forbs
[32]. However, in sugar maple-beech-yellow birch forests, seedlings of
the three dominants were approximately equally abundant [40]. In mature
hemlock-hardwood forests in New York, yellow birch was the third most
common seedling species, distributed randomly as to canopy type [26].
Yellow birch seedlings tend to occur in clumps. The abundance of yellow
birch seedlings in Quebec was almost always negatively correlated to
that of other tree species even though its seed abundance was positively
related to that of other species [57]. Sugar maple seedlings produce an
allelopathic substance that inhibits the root growth of yellow birch
seedlings [112].

Early Successional Stands: Yellow birch is a common early to
mid-successional associate in aspen-birch stands [28]. In northern
hardwood ecosystems, yellow birch reaches maximum importance levels
within 15 years of disturbance, and those levels are maintained for at
least 100 years [81]. On Isle Royale, Michigan, a paper birch-dominated
stand that originated after fire early in this century is undergoing
canopy invasion by sugar maple and yellow birch [50]. In New Hampshire,
succession was monitored after experimental deforestation and 3 years of
vegetation suppression. Yellow birch comprised 0.6 percent of total
biomass in the first year of succession, and increased to 11.8 percent
in the nineteenth year [97]. Second-growth stands usually contain
approximately the same percentage of yellow birch as virgin stands [32].
Yellow birch occurs on fine till with importance peaking at about 80
years. On sandy soils, the trend is indistinct, probably declining over
time [71]. On old fields in Tennessee, succession included small
amounts of yellow birch in 15-year-old stands. Yellow birch occurred at
maximum density on 42- and 48-year-old plots, was present in lower
numbers on the 63-year-old plot, and was not present in the old-growth
plots [21].

Mid- to Late-Successional Stands: Yellow birch is abundant in mid- to
late-successional balsam fir-yellow birch-paper birch-white spruce
(Picea glauca) stands on Isle Royale [50]. It is a major gap-phase
component of sugar maple-beech-yellow birch and hemlock-yellow birch
cover types [32]. The age distribution of yellow birch in a virgin
northern hardwoods forest was somewhat irregular: There were many
10-year-old saplings, no 40-year-old trees, and many 100-year-old trees
[69]. In Wisconsin, even-aged northern hardwoods contain a high
proportion of yellow birch and uneven-aged stands tend towards pure
sugar maple [80]. In many old-growth stands, yellow birch gradually
decreases in importance as the stand ages. In Tennessee, in both
hemlock-mixed forest and mixed deciduous forest, yellow birch decreased
between 1935 and 1987 in undisturbed stands [17].

Climax Stands: Cary [128] described a climax forest in Maine consisting
of red spruce, American beech, maples, and yellow birch. Hansen and
others [50] described a yellow birch-sugar maple type as the climax
forest on Isle Royale, Michigan. These forests have not experienced
major disturbances for more than 120 years and include yellow birch of
up to 150 years of age [50]. Yellow birch was present in old-growth
forests in New York. The average ages of yellow birch trees in two
stands were 200 and 250 years [75]. Forcier [40] explained the presence
of yellow birch in climax stands as a combination of longevity and
micro-succession. At the single tree level, yellow birch is replaced by
sugar maple which is replaced by beech, which, following a small-scale
disturbance, is replaced by yellow birch [40].
  • 87. Mladenoff, David J. 1990. The relationship of the soil seed bank and understory vegetation in old-growth northern hardwood-hemlock treefall gaps. Canadian Journal of Botany. 68: 2714-2721. [13477]
  • 17. Busing, Richard T. 1989. A half century of change in a Great Smoky Mountains cove forest. Bulletin of the Torrey Botanical Club. 116(3): 283-288. [10901]
  • 18. Busing, Richard T.; Clebsch, Edward E. C.; Eagar, Christopher C.; Pauley, Eric F. 1988. Two decades of change in a Great Smoky Mountains spruce-fir forest. Bulletin of the Torrey Botanical Club. 115(1): 25-31. [4491]
  • 21. Clebsch, Edward E. C.; Busing, Richard T. 1989. Secondary succession, gap dynamics, and community structure in a southern Appalachian cove forest. Ecology. 70(3): 728-735. [6972]
  • 26. Collins, Scott L. 1990. Habitat relationships and survivorship of tree seedlings in hemlock-hardwood forest. Canadian Journal of Botany. 68: 790-797. [11368]
  • 28. DeGraaf, Richard M.; Yamasaki, Mariko; Leak, William B.; Lanier, John W. 1992. New England wildlife: management of forested habitats. Gen. Tech. Rep. NE-144. Radnor, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 271 p. [19322]
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 40. Forcier, Lawrence K. 1975. Reproductive strategies and the co-occurrence of climax tree species. Science. 198: 808-810. [11371]
  • 50. Hansen, H. L.; Krefting, L. W.; Kurmis, V. 1973. The forest of Isle Royale in relation to fire history and wildlife. Tech. Bull. 294; Forestry Series 13. Minneapolis, MN: University of Minnesota, Agricultural Experiment Station. 44 p. [8120]
  • 56. Houle, Gilles. 1991. Regenerative traits of tree species in a deciduous forest of northeastern North America. Holarctic Ecology. 14(2): 142-151. [14474]
  • 57. Houle, Gilles. 1992. Spatial relationship between seed and seedling abundance and mortality in a deciduous forest of north-eastern North America. Journal of Ecology. 80: 99-108. [18756]
  • 69. Leak, W. B. 1975. Age distribution in virgin red spruce and northern hardwoods. Ecology. 56: 1451-1454. [8690]
  • 71. Leak, William B. 1991. Secondary forest succession in New Hampshire, USA. Forest Ecology and Management. 43: 69-86. [16683]
  • 75. Leopold, Donald J.; Reschke, Carol; Smith, Daniel S. 1988. Old-growth forests of Adirondack Park, New York. Natural Areas Journal. 8(3): 166-189. [13998]
  • 80. Maissurow, D. K. 1941. The role of fire in the perpetuation of virgin forests of northern Wisconsin. Journal of Forestry. 39(2): 201-207. [3445]
  • 81. Marks, P. L. 1974. The role of pin cherry (Prunus pensylvanica L.) in the maintenance of stability in northern hardwood ecosystems. Ecological Monographs. 44: 73-88. [4144]
  • 97. Reiners, William A. 1992. Twenty years of ecosystem reorganization following experimental deforestation and regrowth suppression. Ecological Monographs. 62(4): 503-523. [19822]
  • 102. Runkle, James Reade. 1982. Patterns of disturbance in some old-growth mesic forests of eastern North American. Ecology. 63(5): 1533-1546. [9261]
  • 112. Tubbs, Carl H. 1973. Allelopathic relationship between yellow birch and sugar maple seedlings. Forest Science. 19(2): 139-145. [6970]
  • 122. White, Peter S.; MacKenzie, Mark D.; Busing, Richard T. 1985. Natural disturbance and gap phase dynamics in southern Appalachian spruce-fir forests. Canadian Journal of Forest Research. 15: 233-240. [9294]
  • 128. Carey, Andrew B. 1983. Cavities in trees in hardwood forests. In: Davis, Jerry W.; Goodwin, Gregory A.; Ockenfeis, Richard A., technical coordinators. Snag Habitat management: proceedings of the symposium; 1983 June 7-9; Flagstaff, AZ. Gen. Tech. Rep. RM-99. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 167-184. [17833]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regeneration Processes

More info for the terms: cover, duff, hardwood, litter, natural, tree

Yellow birch reproduces primarily by seed; seedlings and young saplings
will sprout but sprouts are weak and short lived. Older trees do not
sprout [32,74].

Reproductive Age and Seed Crop Production: Under normal conditions,
yellow birch first reproduces at about 40 years. Optimum seed
production occurs at about 70 years of age. However, seeds have been
produced by 7-year-old open-grown saplings, and heavy seed crops have
been produced by 30- to 40-year-old yellow birch in open-grown positions
or in thinned stands. Yellow birch produces good seed crops at 1- to
4-year intervals, usually with very little seed produced in intervening
years [1,32]. Out of every 10 years, yellow birch averages 1 heavy seed
year, 3.5 medium years, 4.5 light or very light years, and 1 year of
seed failure [82]. The maximum number of successive good crops was 4
years [45]. Yellow birch is a prolific seed producer, and viability is
usually good [32], although seed quality is variable from year to year
[60,82]. Seed longevity up to 8 years has been achieved under
laboratory conditions; under natural conditions viability drops off
rapidly the second year [58,60]. However, Roberts and Dong [99]
reported that a substantial amount of yellow birch regeneration was
derived from 2-year-old seed.

Seed Dispersal: Yellow birch seed is disseminated by wind, most of the
seed falling after cold weather begins. The winged nutlets may travel
up to 1,320 feet (400 m) over crusted snow [32]. Effective dispersal is
approximately 2 to 4 times tree height [74]. Korstian [65] estimated
that if yellow birch seeds are released from 50 feet (15 m),
in a 5 mile per hour wind, 50 percent will fall within 700 feet (213 m)
of the release point, and 90 percent within 820 feet (250 m).

Seed Germination: Yellow birch seeds contain a water-soluble
germination inhibitor. This inhibitor is inactivated by light. Under
artificial conditions, seed dormancy is broken by stratification or by
exposure of imbibed seed to cool-white fluorescent light [32]. Yellow
birch seeds germinate and grow best on moist mineral soil enriched with
humus; bare mineral soil and duff alone are unsuitable substrates
[16,64,82,124]. However, in undisturbed stands, germination of yellow
birch seeds usually occurs on mossy logs, decayed wood, in cracks in
boulders and on windthrown tree hummocks [32,67]. Optimum germination
of yellow birch occurs at 59 to 61 degrees Fahrenheit (15-16 deg C)
[27]. A substrate pH of 2.4 completely inhibited germination, and pH
3.0 partly inhibited germination (50.7 percent) [94,96].

Seedling Establishment and Growth: Yellow birch seedlings require
overhead light, crown expansion space, and plentiful soil moisture and
nutrients to compete with faster growing associates; conditions found in
gaps are conducive to yellow birch seedling establishment [1,32]. Some
shade improves seedling survival [82]. In one study, heavily shaded
(14-25% of full sun) yellow birch seedlings grew taller and had more
leaf area than those in full sun, but unshaded seedlings accumulated
more biomass [127]. Mortality of yellow birch seedlings is usually very
high [121]. In one study, minimum mortality was estimated as 97 percent
14 months after germination. Seedling survival is better on disturbed
microsites; seedlings that germinate on litter are unlikely to survive
[26,40]. Seedlings surviving their first year survive to sapling and
larger stages only where there is sufficient light [121]. Surviving
seedlings in hemlock-northern hardwood forests occur on microhabitats
with slightly lower canopy cover than in the surrounding area, primarily
under coniferous rather than mixed canopies [26]. Growth is better on
humus over sandy loams than on decayed logs, mineral soil, or litter
[124].

Vegetative Reproduction: Greenwood cuttings of yellow birch have been
successfully rooted and overwintered. Propagation by grafting is also
possible [32].
  • 1. A. D. Revill Associates. 1978. Ecological eff. of fire and its mgmt. in Canada's national parks: a synthesis of the literature. Vols 1&2. Lit. Rev. & Annot. Bibliography. Ottawa, ON: Parks Canada, National Parks Branch, Natural Resources Division. 345 p. [3416]
  • 94. Raunkiaer, C. 1934. The life forms of plants and statistical plant geography. Oxford: Clarendon Press. 632 p. [2843]
  • 16. Burton, D. H.; Anderson, H. W.; Riley, L. F. 1969. Natural regeneration of yellow birch in Canada. In: The birch symposium: Proceedings; 1969 August 19-21; Durham, NH. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 55-73. [21870]
  • 26. Collins, Scott L. 1990. Habitat relationships and survivorship of tree seedlings in hemlock-hardwood forest. Canadian Journal of Botany. 68: 790-797. [11368]
  • 27. Crow, Thomas R.; Metzger, Fredrick T. 1987. Regeneration under selection cutting. In: Nyland, Ralph D., editor. Managing northern hardwoods: Proceedings of a silvicultural symposium; 1986 June 23-25; Syracuse, NY. Faculty of Forestry Miscellaneous Publication No. 13 (ESF 87-002); Society of American Foresters Publication No. 87-03. Syracuse, NY: State University of New York, College of Environmental Science and Forestry: 81-94. [10651]
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 40. Forcier, Lawrence K. 1975. Reproductive strategies and the co-occurrence of climax tree species. Science. 198: 808-810. [11371]
  • 45. Godman, Richard M.; Mattson, Gilbert A. 1976. Seed crops and regeneration problems of 19 species in northeastern Wisconsin. Res. Pap. NC-123. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 5 p. [3715]
  • 58. Houle, Gilles; Payette, Serge. 1990. Seed dynamics of Betula alleghaniensis in a deciduous forest of northeastern North America. Journal of Ecology. 78: 677-690. [13325]
  • 60. Hughes, Jeffrey W.; Fahey, Timothy J. 1988. Seed dispersal and colonization in a disturbed northern hardwood forest. Bulletin of the Torrey Botanical Club. 115(2): 89-99. [10894]
  • 64. Kelty, Matthew J. 1987. Shelterwood cutting as an even-aged reproduction method. In: Nyland, Ralph D., editor. Managing northern hardwoods: Proceedings of a silvicultural symposium; 1986 June 23-25; Syracuse, NY. Faculty of Forestry Miscellaneous Publication No. 13 (ESF 87-002); Society of American Foresters Publication No. 87-03. Syracuse, NY: State University of New York, College of Environmental Science and Forestry: 128-142. [10653]
  • 65. Korstian, Clarence F. 1937. Perpetuation of spruce on cut-over and burned lands in the higher Southern Appalachian Mountains. Ecological Monographs. 7(1): 125-167. [11233]
  • 67. Kudish, Michael. 1992. Adirondack upland flora: an ecological perspective. Saranac, NY: The Chauncy Press. 320 p. [19376]
  • 74. Lees, John C. 1987. Clearcutting as an even-aged reproduction method. In: Nyland, Ralph D., editor. Managing northern hardwoods: Proceedings of a silvicultural symposium; 1986 June 23-25; Syracuse, NY. Faculty of Forestry Miscellaneous Publication No. 13 (ESF 87-002); Society of American Foresters Publication No. 87-03. Syracuse, NY: State University of New York, College of Environmental Science and Forestry: 115-127. [10652]
  • 82. Marquis, David A. 1969. Silvical requirements for natural birch regeneration. In: The birch symposium: Proceedings; 1969 August 19-21; Durham, NH. Res. Pap. NE-146. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 40-49. [15116]
  • 96. Raynal, D. J.; Roman, J. R.; Eichenlaub, W. M. 1982. Response of tree seedlings to acid precipitation. I. Effect of substrate acidity on seed germination. Environmental and Experimental Botany. 22(3): 377-383. [12531]
  • 99. Roberts, Mark R.; Dong, Hongyun. 1991. Eff. of forest floor disturb. on soil seed banks, germ. & early survival after clearcutting a northern hardwood stand in central New Brunswick. In: Simpson, C. M., ed. Proceedings of the conference on natural regeneration management; 1990 March 27-28; Fredericton, NB. Fredericton, NB: Forestry Canada, Maritimes Region: 67-84. [17191]
  • 121. White, Peter S. 1979. Pattern, process, and natural disturbance in vegetation. Botanical Review. 45(3): 229-299. [7869]
  • 124. Winget, C. H.; Cottam, G.; Kozlowski, T. T. 1965. Species association and stand structure of yellow birch in Wisconsin. Forest Science. 11(3): 369-383. [21189]
  • 127. Gordon, Robert B. 1969. The natural vegetation of Ohio in pioneer days. Bulletin of the Ohio Biological Survey. New Series Vol. 3: No. 2. Columbus, Ohio: The Ohio State University. 113 p. [21105]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth Form (according to Raunkiær Life-form classification)

More info on this topic.

More info for the term: phanerophyte

Phanerophyte

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Form

More info for the term: tree

Tree

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reaction to Competition

Yellow birch is generally  considered intermediate in shade tolerance and competitive  ability (45). It is more shade tolerant than the other native  birches, but less tolerant than its major associates, sugar maple  (Acer saccharum), beech (Fagus grandifolia), and  hemlock (Tsuga). Yellow birch is the major gap-phase  component of the forest cover types Sugar Maple- Beech-Yellow  Birch and Hemlock-Yellow Birch. It cannot regenerate under a  closed canopy; it must have soil disturbance and an opening in  the canopy (125). It tends to be stable on moist sites but gives  way with age to more tolerant species on dry sites.

    Yellow birch is often a pioneer species following  fires but is usually less abundant than aspen (Populus),  pin cherry (Prunus pensylvanica), and paper birch (Betula  papyrifera). Birch seedlings cannot compete successfully with  advance regeneration, grass, and herbaceous plants. An  allelopathic relation between yellow birch and sugar maple  seedlings has been noted (118). Advance sugar maple regeneration  offers the stiffest competition in the Sugar Maple-Beech-Yellow  Birch cover type, while red maple (Acer rubrum) sprouts  are the most serious problem on wetter sites in the Lake States.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

G. G. Erdmann

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rooting Habit

Yellow birch has an adaptable  well-developed, extensive lateral root system. Its roots are  capable of either spreading horizontally through shallow soils or  penetrating to depths of more than 1.5 rn (5 ft) under favorable  conditions. Roots often follow old root channels in compacted  soil layers. Rooting patterns of older trees in unmanaged stands  may be modified by their origin on decayed wood and stumps (fig.  3). Within- and between-tree root grafting is common in birch  (42).

    Irregularly distributed lateral roots of sapling  and pole-size trees often extend well beyond their crown perimeters  (120). Most root systems have irregular circular or oval shapes.  Roots of trees on slopes are usually concentrated along the  contour and the uphill side of the stem. Main laterals are close  to the soil surface and usually have one or two sinker roots  within 1.8 m (6 ft) of the stem. These sinkers often penetrate to  impervious layers (53). Replacement root growth is active from  leafout (May 5) until late October in southern New Hampshire  (99).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

G. G. Erdmann

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology

More info on this topic.

More info for the term: phenology

The pistillate catkins of yellow birch form in the fall, and finish
development from late May to early June. The fruit ripens from late
August to early September [32]. The phenology of yellow birch in
northern Minnesota was reported as follows [4]:

flower appearance April 2 to May 16
initial bud swell April 6 to May 1
leaf out May 3 to May 25
anthesis May 13 to May 29
seed fall (initiation) August 6
leaf fall September 26 to October 4
  • 4. Ahlgren, C. E. 1957. Phenological observations of nineteen native tree species in northeastern Minnesota. Ecology. 38(4): 622-628. [74]
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flowering/Fruiting

Flowering late spring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Vegetative Reproduction

Yellow birch seedlings  and small saplings reproduce from sprouts when cut, but sprouting  from larger stems is very poor (93,111).

    Greenwood cuttings of birch have been successfully  rooted (45) and overwintered (56). The species can also be  propagated by grafting (17).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

G. G. Erdmann

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seedling Development

Yellow birch seeds dispersed  in the fall and winter germinate at warm temperatures in early  June. Germination is epigeal. In undisturbed stands, yellow birch  can only regenerate on mossy logs, decayed wood, rotten stumps,  cracks in boulders, and windthrown hummocks because hardwood leaf  litter is detrimental to its survival elsewhere (45). In June  most seeds germinate in compacted leaf litter that birch radicals  and hypocotyls cannot pierce (10). Drying of the litter during  the growing season kills most germinants. The remaining seedlings  later succumb to frost damage or are smothered by the next leaf  fall.

    Unless stands have been burned or heavily  disturbed by blowdowns or logging, abundant birch regeneration is  normally restricted to edges of skidroads or landing areas on  well-drained sites. On less-well-drained soils, sufficient  moisture remains in the leaf litter to result in adequate  establishment if advance regeneration of other species is removed  (117).

    The most important factors affecting the catch of  yellow birch seedlings are an adequate seed supply, favorable  weather, proper seedbed conditions, adequate light, and control  of competition.

    Removing advance regeneration is at least as  important as preparing proper seedbeds (121). Scarification  fulfills both requirements and, when coupled with opening of the  canopy, can greatly increase the initial catch of birch seedlings  (45). Optimum seedling survival and growth, however, occur on  disturbed humus or mixed humus mineral soil seedbeds in the  absence of advance regeneration (126).

    Mechanical scarification and prescribed burning  are used to prepare receptive seedbeds and eliminate advance  regeneration. Scarification should be shallow to mix humus and  mineral soil and to expose 50 to 75 percent of the area (46,88).  Spring burning during and shortly after leafout in years with  abundant male birch catkins may also control competition from  advanced regeneration and provide seed for successful birch  regeneration. Treatments should coincide with good seed crops  because the effects of scarification are largely lost after two  or three growing seasons.

    Under dense forest canopies (13 and 15 percent of  full sunlight) yellow birch roots grow slower than sugar maple  seedlings (81). As a result, few yellow birch become established  under selection cutting (43).

    The optimum light level for top growth and root  development of birch seedlings up to 5 years old is 45 to 50  percent of full sunlight (43). The best root-to-shoot ratios are  also produced at similar light levels (86). In field studies, the  greatest 2-year height growth occurred at the lowest canopy  density of 0 to 14 percent, and on mixed humus and mineral soil  seedbeds it occurred under canopy densities between 29 and 50  percent (123). Moderate side shade is beneficial to birch  seedlings during their first 5 years (124).

    Clearcutting small patches or strips provides  suitable conditions for yellow birch seedling establishment in  the Northeast where rainfall is abundant. Scarified clearcut  patches of 0.04 to 0.24 ha (0.1 to 0.6 acre) produce good catches  of birch regeneration. Patches are difficult to manage but can be  used in uneven-aged management to increase the proportion of  birch (43) when groups of mature or defective trees are harvested  (85).

    In the dry western part of the species range,  success with strip clearcutting to regenerate birch has been too  variable to generally recommend its use. In Upper Michigan  success depends on a good seed crop, favorable weather, and  control of advance regeneration (89). Although strips 20 and 40  in (66 and 132 ft) wide were equally well stocked with birch  seedlings after 6 or 7 years in Michigan, strips 20 in (66 ft)  wide are about optimum in Canada (10), and strips 15 in (50 ft)  wide are recommended in the Northeast (43).

    Clearcuttings of 2 to 4 ha (5 to 10 acres) and  uniform selection cuttings are not as effective as smaller  patches or the shelterwood method for establishing yellow birch  stands (87,90). In the western part of its range, birch  regenerates best under shelterwood cuttings (48,121). Ten  well-distributed yellow birch seed trees per hectare (4/acre)  provide an adequate seed supply (88). Otherwise, 0.56 kg/ha (0.5  lb/acre) of stratified (6 to 8 weeks at 5' C (41' C) birch seed   can be applied about a week after site preparation in May (46) or  unstratified seed can be sown before January (48).

    Yellow birch can also be successfully established  by planting 2-0 stock 15 to 50 cm (6 to 20 in) tall on 0.08 ha  (0.2 acre) clearcut patches (97).

    Yellow birch seedling growth in the Northeast is  limited by inadequate soil fertility in acid sandy subsoils and  can be greatly improved by deep fertilizing with phosphorus and  lime to correct phosphorus deficiency and aluminum toxicity (61).  Aluminum is toxic to roots, especially in subsoils, deficient in  magnesium and sulfur. Seedling roots are tolerant of aluminum  concentrations or up to 80 p/m but concentration of 120 p/m or  more are toxic (84).

    Manganese toxicity in seedlings occurs above  foliar concentrations of more than 1,300 p/m; concentrations of  less than 60 p/m are deficient; and 440 p/m are optimum (64).

    Optimum nursery seedbed density is about 160  seedlings per square meter (15/ft²) (45). Normally 2-0 stock  averaging 28 cm (11 in) tall with roots 23 cm (9 in) long and 5  mm (0.2 in) in stem caliper is large enough for dormant spring  planting. For early starts in the greenhouse, seedlings require  at least 2 months of cold storage to break dormancy (34).  Containerized planting is feasible (11,50,115). In 3 months  seedlings 40 to 50 cm (16 to 20 in) tall can be produced in the  greenhouse using 20-hour days with supplemental cool-white  fluorescent and incandescent light (17). Growth can also be  accelerated by using plastic greenhouses (94).

    After 5 years, yellow birch seedlings are normally  overtopped by faster-growing species and require complete release  from overstory shading for best survival, growth, and quality  development. Photosynthetic rates of overtopped seedlings are  only 54 to 70 percent of those grown in full sunlight and their  dry weights are 66 percent lower (82).

    Birch crop trees in Vermont and Michigan seedling  stands (up to 2.5 cm or 1 in d.b.h.) have benefited from cleaning  or early release (40,55). After 9 years, trees cleaned to within  a 2.4 in (8 ft) radius of the bole radius in Michigan exhibited  the best stem, crown, and branch characteristics. They averaged 2  cm (0.8 in) larger in d.b.h. and 0.5 rn (1.6 ft) taller than the  control trees. Shoot growth of yellow birch partly depends upon  current photosynthate (73). The shoot elongation period for  released saplings (1.5-m or 5-ft radius) can be extended up to 30  days by making more light and moisture available to them (55).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

G. G. Erdmann

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seed Production and Dissemination

Normally, 40 years is  considered the minimum and 70 years the optimum seed-bearing age  for yellow birch (45), but heavy seed crops are also produced by  30- to 40-year-old trees in either open-grown positions or  thinned stands. However, open-grown progeny test saplings with  large crowns bear viable seed at 7 years and male catkins at 8  years (21). Germinable seed has also been obtained from  16-year-old trees 5 to 10 cm (2 to 4 in) in d.b.h. and 6.7 to 7.6  rn (22 to 25 ft) tall.

    Good seed crops usually occur at about 2 to 3 year  intervals but the frequency of good or better seed crops  varies-every 1 to 4 years in northeastern Wisconsin (47), and  every 2 to 3 years in Maine, and every 3 years in Ontario (10).  Consecutive good or better seed crops only occurred once in the  26-year Wisconsin study; 60 percent of the intervening crops  failed or were poor. Seed-crop failures are often caused by hard  frost in late spring or early fall or by insects and disease. The  percentage of viable seeds produced varies each year and can be  very low due to a high proportion of seedcoats without embryos,  probably caused by parthenocarpy (14). Seed viability is often  affected by weather conditions during pollination, fertilization,  and seed development. It also varies by locality, stand, and  individual trees within the same stand.

    Although some seeds fall shortly after they mature  in August, the first heavy seedfall in Canada and the northern  United States comes with cold weather in October. Contrary to  earlier reports, larger seeds are not shed first nor is their  germination capacity any better than that of smaller filled seeds  (17).

    Yellow birch seeds are light, averaging 99,200/kg  (45,000/lb) (8). They are dispersed by the wind and blown up to  400 m (1,320 ft) over crusted snow (10). Dispersal of adequate  amounts for regeneration is at least 100 m (330 ft) from the edge  of a fully stocked mature northern hardwood stand.

    Yellow birch is a prolific seeder, producing  between 2.5 and 12.4 million seeds per hectare (1 to 5  million/acre) in good seed years (45), and up to 89 million/ha  (36 million/acre) in a bumper seed year (52). Seed viability is  usually good in years with heavy seed crops and poor in years  with light crops. Germinative capacity in good seed years is  still low, however, averaging about 20 percent under natural  conditions.

    The next seed crop can be estimated from the  abundance of the overwintering male catkins (88). Fairly reliable  estimates of the fall yellow birch seed crop can also be obtained  from the size of the spring-maturing red maple crop (47).

    Yellow birch seedcoats contain a water-soluble  germination inhibitor that is inactivated by light (17). Seed  dormancy can be broken down artificially either by stratifying  the seed in moist peat or sand at 5° C (41° F) for 4 to  8 weeks or by germinating unchilled seeds in a water medium under  "cool-white" fluorescent light for more than 20 days.  Germination test results are always higher when unchilled rather  than stratified seeds are used (8). Following stratification,  seeds are germinated at alternating day and night temperatures of  32° C and 15° C (90° F and 59° F) for 30 to  40 days, and alternating temperature of 30° C and 20° C  (86° F and 68° F) with at least 8-hour light periods  are used for unchilled seeds. Germination percentages exceeding  90 percent are common in good seed years.

    Seeds can be stored in tightly closed bottles at  from 2 to 4° C (36 to 40° F) for 4 years without losing  viability (17). Some seed lots stored well for 8 years and one  lot still had 65 percent germination after 12 years (19).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

G. G. Erdmann

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Betula alleghaniensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATATAGGGACTCTATATTTCATCTTCGGTGCCATTGCTGGAGTGATGGGCACATGCTTCTCAGTACTGATTCGTATGGAATTAGCACGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAATAACGGCTCACGCTTTTTTAATGATCTTTTTTATGGTTATGCCGGCGATGATAGGTGGATCTGGTAATTGGTCTGTTCCGATTCTGATAGGTGCACCTGACATGGCATTTCCACGATTAAATAATATTTCATTCTGGTTGTTGCCACCAAGTCTCTTGCTCCTATTAAGCTCAGCCTTAGTAGAAGTGGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCTTAAGTGGTATTACCAGCCATTCCGGAGGAGCAGTTGATTCAGCAATTTCCAGTCTTCATCTATCTGGTGTTTCATCCATTTTAGGTTCTATCAATTTTATAACAACTATCTCCAACATGCGTGGACCTGGAATGACTATGCATAGATCACCCCTATTTGTGTGGTCCGTTCTAGTGACAGCATTCCCACTTTTATTATCACTTCCGGTACTGGCAGGGGCAATTACCATGTTATTAACCGATCGAAACTTTAATACAACCTTTTTTGATCCCGCTGGAGGTGGAGACCCCATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Betula alleghaniensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: T4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Please consult the PLANTS Web site and your State Department of Natural Resources for this plant’s current status, such as, state noxious status and wetland indicator values.

Public Domain

USDA NRCS National Plant Data Center & Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management considerations

More info for the terms: hardwood, selection

Numerous management guidelines for yellow birch and yellow
birch-containing types [43,46,73,111], and recommendations for
silvicultural treatments [68,98,113,114] are available in the
literature. Shaw [104] reported on management considerations for
wildlife in northern hardwoods.

Harvest System and Regeneration: Yellow birch regenerates primarily by
germination; very little advance regeneration is usually present
[38,60]. Early twentieth century logging practices that favored shade
tolerant species resulted in a decrease in yellow birch [84]. The
effects of different harvesting systems and conditions on yellow birch
regeneration have been studied and reviewed [70,92,109]. Harvest should
coincide with good seed years [99]. Clearcutting small patches or
strips provides suitable conditions for yellow birch seedling
establishment in the Northeast [32,38,74,82,84]. Yellow birch
reproduces well on patch cuttings of up to 0.3 acre (0.12 ha) [43]. In
New Hampshire, strip cutting failed to increase the proportion of yellow
birch in the stand but it did increase the percentage of yellow birch
likely to become crop trees [47]. Group selection can significantly
increase the proportion of yellow birch by creating openings for yellow
birch regeneration [27,83]. In New Hampshire, after 38 years of group
selection yellow birch comprised one-quarter to one-third of the trees
in the 4- to 12-inch d.b.h. class. The pretreatment proportion was not
reported; however, under single-tree selection yellow birch will usually
decline to less than 20 percent, and sometimes to less than 10 percent,
of stocking [27,72]. In the Great Lakes States, 20 years after group
selection yellow birch had not increased in proportion to other species
[34]. Shelterwood systems designed to increase the proportion of yellow
birch have been investigated [46,49,64,115].

Seedbed Preparation: Scarification of seedbeds improves yellow birch
seedling establishment [38], although the effects may be short-lived if
organic matter is scraped away rather than mixed in with the mineral
soil [64]. Yellow birch can be direct seeded after harvest in the
northern hardwood forest zone [45].

Harvesting Considerations: Yellow birch is windfirm on deep,
well-drained loam and sandy loam soils, but is subject to windthrow on
shallow, poorly drained soils. It is susceptible to winter sunscald
[32]. Yellow birch is sensitive to high soil temperatures and sudden
exposure [43]. It is also susceptible to root, stem, and crown injury
due to logging and is subject to insect attack as a consequence of
injury. Top dieback and some mortality occur after heavy cuts in mature
and overmature stands [32].

Damaging Agents: Yellow birch is susceptible to ice and snow load
damage, and young trees are vulnerable to late spring frosts. Yellow
birch is susceptible to injury at 3.5 ppm sulfur dioxide but is tolerant
of ozone at 0.25 ppm [32]. Hacker and Renfro [48] rated yellow birch as
slightly sensitive to ozone. Top dieback sometimes occurs following
heavy seed crops [32]. Heavy or repeated browsing by deer and moose
kills small yellow birch. Sometimes browsing prevents regeneration
[62]. In New York, growth of yellow birch was not detected on
postharvest plots that were unfenced [11]. Porcupine feeding damages
birch crowns, reduces wood quality, and is sometimes fatal. Red
squirrel cut new germinants [32]. Heavy feeding by yellow-bellied
sapsucker reduces growth, lowers wood quality, and is sometimes fatal
[32]. Yellow birch has relatively few species-specific insect pests,
but is frequently attacked by pests typically associated with other
northern hardwood species [5]. Insect and disease damaging agents are
listed [32].
  • 5. Allen, Douglas C. 1987. Insects, declines and general health of northern hardwoods: issues relevant to good forest management. In: Nyland, Ralph D., editor. Managing northern hardwoods: Proceedings of a silvicultural symposium; 1986 June 23-25; Syracuse, NY. Faculty of Forestry Miscellaneous Publication No. 13 (ESF 87-002); Society of American Foresters Publication No. 87-03. Syracuse, NY: State University of New York, College of Environmental Science and Forestry: 252-285. [10659]
  • 11. Behrend, Donald F.; Patric, Earl F. 1969. Influence of site disturbance and removal of shade on regeneration of deer browse. Journal of Wildlife Management. 33(2): 394-398. [15619]
  • 27. Crow, Thomas R.; Metzger, Fredrick T. 1987. Regeneration under selection cutting. In: Nyland, Ralph D., editor. Managing northern hardwoods: Proceedings of a silvicultural symposium; 1986 June 23-25; Syracuse, NY. Faculty of Forestry Miscellaneous Publication No. 13 (ESF 87-002); Society of American Foresters Publication No. 87-03. Syracuse, NY: State University of New York, College of Environmental Science and Forestry: 81-94. [10651]
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 34. Eyre, F. H.; Zillgitt, W. M. 1953. Partial cuttings in northern hardwoods of the Lake States: twenty-year experimental results. Tech. Bull. No. 1076. Washington, DC: U.S. Department of Agriculture. 124 p. [23839]
  • 38. Filip, Stanley M. 1969. Natural regeneration of birch in New England. In: The birch symposium: Proceedings; 1969 August 19-21; Durham, NH. Forest Service Research Paper NE-146. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 50-54. [15350]
  • 43. Gilbert, Adrian M.; Jensen, Victor S. 1958. A management guide for northern hardwoods in New England. Station Paper No. 112. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station, 22 p. [10982]
  • 45. Godman, Richard M.; Mattson, Gilbert A. 1976. Seed crops and regeneration problems of 19 species in northeastern Wisconsin. Res. Pap. NC-123. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 5 p. [3715]
  • 46. Godman, Richard M.; Tubbs, Carl H. 1973. Establishing even-age northern hardwood regeneration by the shelterwood method--a preliminary guide. Res. Pap. NC-99. St. Paul, MI: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 9 p. [11372]
  • 47. Gove, Jeffrey H.; Martin, C. Wayne; Patil, Gianapati P.; [and others]
  • 48. Hacker, David; Renfro, James. 1992. Great Smoky Mountain plants studied for ozone sensitivity. Park Science. 12(1): 6-7. [17788]
  • 49. Hannah, Peter R. 1991. Regeneration of northern hardwoods in the Northeast with the shelterwood method. Northern Journal of Applied Forestry. 8(3): 99-104. [5351]
  • 60. Hughes, Jeffrey W.; Fahey, Timothy J. 1988. Seed dispersal and colonization in a disturbed northern hardwood forest. Bulletin of the Torrey Botanical Club. 115(2): 89-99. [10894]
  • 62. Jordan, James S.; Rushmore, Francis M. 1969. Animal damage to birch. In: The birch symposium: Proceedings; 1969 August 19-21; Durham, NH. Res. Pap. NE-146. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 155-163. [15354]
  • 64. Kelty, Matthew J. 1987. Shelterwood cutting as an even-aged reproduction method. In: Nyland, Ralph D., editor. Managing northern hardwoods: Proceedings of a silvicultural symposium; 1986 June 23-25; Syracuse, NY. Faculty of Forestry Miscellaneous Publication No. 13 (ESF 87-002); Society of American Foresters Publication No. 87-03. Syracuse, NY: State University of New York, College of Environmental Science and Forestry: 128-142. [10653]
  • 68. Lamson, Neil I.; Smith, H. Clay. 1987. Precommercial treatments of 15- to 40-year old northern hardwood stands. In: Nyland, Ralph D., editor. Managing northern hardwoods: Proceedings of a silvicultural symposium; 1986 June 23-25; Syracuse, NY. Faculty of Forestry Miscellaneous Publication No. 13 (ESF 87-002); Society of American Foresters Publication No. 87-03. Syracuse, NY: State University of New York, College of Environmental Science and Forestry: 160-175. [10655]
  • 70. Leak, William B. 1988. Effects of weed species on northern hardwood regeneration in New Hampshire. Northern Journal of Applied Forestry. 5: 235-237. [10889]
  • 72. Leak, W. B.; Filip, L. M. 1977. Thirty-eight years of group selection in New England northern hardwoods. Journal of Forestry. 75: 641-643. [23838]
  • 73. Leak, William B.; Solomon, Dale S.; Filip, Stanley M. 1969. A silvicultural guide for northern hardwoods in the northeast. Res. Pap. NE-143. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 34 p. [10976]
  • 74. Lees, John C. 1987. Clearcutting as an even-aged reproduction method. In: Nyland, Ralph D., editor. Managing northern hardwoods: Proceedings of a silvicultural symposium; 1986 June 23-25; Syracuse, NY. Faculty of Forestry Miscellaneous Publication No. 13 (ESF 87-002); Society of American Foresters Publication No. 87-03. Syracuse, NY: State University of New York, College of Environmental Science and Forestry: 115-127. [10652]
  • 82. Marquis, David A. 1969. Silvical requirements for natural birch regeneration. In: The birch symposium: Proceedings; 1969 August 19-21; Durham, NH. Res. Pap. NE-146. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 40-49. [15116]
  • 83. Marquis, David A.; Johnson, Robert L. 1989. Silviculture of eastern hardwoods. In: Burns, Russell M., compiler. The scientific basis for silvicultural and management decisions in the National Forest System. Gen. Tech. Rep. WO-55. Washington, DC: U.S. Department of Agriculture, Forest Service: 9-15. [10242]
  • 84. Martin, C. Wayne; Hornbeck, James W. 1990. Regeneration after strip cutting and block clearcutting in northern hardwoods. Northern Journal of Applied Forestry. 7: 65-68. [11784]
  • 92. Perala, Donald A.; Alm, Alvin A. 1990. Regeneration silviculture of birch: a review. Forest Ecology and Management. 32: 37-77. [12211]
  • 98. Roberge, Marcien R. 1988. Effects of thinning, patch clearcutting, site preparation, and planting on development of yellow birch in Quebec. Northern Journal of Applied Forestry. 5: 248-251. [10890]
  • 99. Roberts, Mark R.; Dong, Hongyun. 1991. Eff. of forest floor disturb. on soil seed banks, germ. & early survival after clearcutting a northern hardwood stand in central New Brunswick. In: Simpson, C. M., ed. Proceedings of the conference on natural regeneration management; 1990 March 27-28; Fredericton, NB. Fredericton, NB: Forestry Canada, Maritimes Region: 67-84. [17191]
  • 104. Shaw, Samuel P. 1969. Management of birch for wildlife habitat. In: The birch symposium: Proceedings; 1969 August 19-21; Durham, NH. Res. Pap. NE-146. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 181-183. [15355]
  • 109. Thurston, Sally W.; Krasny, Marianne E.; Martin, C. Wayne; Fahey, Timothy J. 1992. Effect of site characteristics and 1st- and 2nd-year seedling densities on forest development in a northern hardwood forest. Canadian Journal of Forest Research. 22: 1860-1868. [20431]
  • 111. Trimble, George R., Jr.; Patric, James H.; Gill, John D.; [and others]
  • 113. Tubbs, Carl H. 1977. Manager's handbook for northern hardwoods in the north central states. Gen. Tech. Rep. NC-39. St, Paul MI: U.S. Department of Agriculture, Forest Service, North central Forest Experiment Station. 29 p. [10974]
  • 114. Tubbs, Carl H. 1977. Age and structure of a northern hardwood selection forest, 1929-1976. Journal of Forestry. 75: 22-24. [19707]
  • 115. Tubbs, Carl H. 1978. Stand composition in relation to uneven-aged silviculture. In: U.S. Department of Agriculture, Forest Service, Timber Management Research, compiler. Uneven-aged silviculture and management in the United States: Proceedings; 1975 July 15-17; 1976 October 19-21; Redding, CA. Gen. Tech. Rep. WO-24. Washington, DC: 88-103. [7318]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivars, improved and selected materials (and area of origin)

The species may be hard to locate in local nurseries, but it can be ordered.

Contact your local Natural Resources Conservation Service (formerly Soil Conservation Service) office for more information. Look in the phone book under ”United States Government”. The Natural Resources Conservation Service will be listed under the subheading “Department of Agriculture.”

Public Domain

USDA NRCS National Plant Data Center & Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Heavy or repeated browsing of yellow birch by deer and moose kills small yellow birch and may prevent regeneration. Heavy feeding by porcupine and yellow-bellied sapsucker reduces growth, lowers wood quality, and is sometimes fatal.

Heavy cuts in older stands may be followed by top dieback and mortality. Recently isolated trees, in particular, are subject to wind throw on shallow soils and susceptible to winter sunscald. All are sensitive to high soil temperatures. Harvest of yellow birch timber should coincide with good seed years, because the trees regenerate primarily by germination, and openings for regeneration should be provided.

Yellow birch can be grown from seed relatively easily. Artificial propagation can be done through greenwood cuttings and by grafting.

Public Domain

USDA NRCS National Plant Data Center & Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Palatability

Yellow birch was listed as a highly preferred browse species in northern
hardwood forests [110]. In New Hampshire, white-tailed deer browsed
birch twigs (both yellow birch and paper birch) at a browse index rate
of approximately 4 (i.e., four times the expected rate based on
availability) [104].
  • 104. Shaw, Samuel P. 1969. Management of birch for wildlife habitat. In: The birch symposium: Proceedings; 1969 August 19-21; Durham, NH. Res. Pap. NE-146. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 181-183. [15355]
  • 110. Tilghman, Nancy G. 1989. Impacts of white-tailed deer on forest regeneration in northwestern Pennsylvania. Journal of Wildlife Management. 53(3): 524-532. [8914]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Other uses and values

Yellow birch can be tapped for sap which is used to make an edible
syrup. Tea can be made from the twigs and/or inner bark [31].

Yellow birch chips can be used to produce ethanol and other products [13].
  • 13. Brink, D. L.; Merriman, M. M.; Gullekson, E. E. 1987. Ethanol fuel, organic chemicals, single-cell proteins: a new forest products industry. In: Plumb, Timothy R.; Pillsbury, Norman H., technical coordinators. Proceedings of the symposium on multiple-use management of California's hardwood resources; 1986 November 12-14; San Luis Obispo, CA. Gen. Tech. Rep. PSW-100. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station: 237-243. [5379]
  • 31. Elias, Thomas S.; Dykeman, Peter A. 1982. Field guide to North American edible wild plants. [Place of publication unknown]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Value for rehabilitation of disturbed sites

Early colonizers of a site denuded of vegetation by brine (used for
well-injection fluid) included yellow birch. Soil salinity levels had
returned to slightly above normal when initial colonization occurred [7].
  • 7. Auchmoody, L. R.; Walters, R. S. 1988. Revegetation of a brine-killed forest site. Soil Science Society of America Journal. 52: 277-280. [11374]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance to Livestock and Wildlife

Yellow birch is browsed by moose, white-tailed deer, and snowshoe hare.
Deer consume large numbers of seedlings in summer, and prefer green
leaves and woody stems in fall [32,104]. Yellow birch seeds are
consumed by common redpoll, pine siskin, chickadees, and other songbirds
[104]. Ruffed grouse feed on seeds, catkins, and buds. Red squirrel
cut and store mature strobili, eat yellow birch seeds, and also feed on
birch sap. The yellow-bellied sapsucker uses yellow birch as a summer
food source [32,104]. Beaver and porcupine chew the bark of yellow
birch [104].
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 104. Shaw, Samuel P. 1969. Management of birch for wildlife habitat. In: The birch symposium: Proceedings; 1969 August 19-21; Durham, NH. Res. Pap. NE-146. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 181-183. [15355]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wood Products Value

Yellow birch is an economically important source of lumber. The wood is
heavy, strong, and close-grained. It is used for furniture, cabinetry,
charcoal, pulp [14], interior finish, veneer, tool handles [29], boxes,
woodenware, and interior doors [32].
  • 14. Brown, Russell G.; Brown, Melvin L. 1972. Woody plants of Maryland. Baltimore, MD: Port City Press. 347 p. [21844]
  • 32. Erdmann, G. G. 1990. Betula alleghaniensis Britton yellow birch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 133-147. [21816]
  • 29. Duncan, Wilbur H.; Duncan, Marion B. 1988. Trees of the southeastern United States. Athens, GA: The University of Georgia Press. 322 p. [12764]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivation

The preference is full or partial sun, moist to mesic conditions, and soil containing loam or sandy loam. This tree is slow-growing and typically lives for about 150 years (unless it is prematurely killed by insects, disease, or other causes). However, the longevity of some trees can extend to 300 years or more. Hot dry weather during the summer can impair the health of this tree.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

The wood of yellow birch is heavy, strong, close-grained, even-textured, and shows a wide color variation, from reddish brown to creamy white. It is used for furniture, cabinetry, charcoal, pulp, interior finish, veneer, tool handles, boxes, woodenware, and interior doors. The wood can be stained and takes a high polish. Yellow birch is one of the principal hardwoods used in the distillation of wood alcohol, acetate of lime, charcoal, tar, and oils.

Deer consume large numbers of yellow birch seedlings in summer and prefer green leaves and woody stems in fall. Moose, white-tailed deer, and snowshoe hare also browse yellow birch. The seeds are eaten by various songbird species, and ruffed grouse feed on seeds, catkins, and buds. Red squirrel cut and store mature catkins and eat the seeds. Beaver and porcupine chew the bark.

The sap of yellow birch can be tapped for use as edible syrup. Tea is sometimes made from the twigs and/or inner bark.

Yellow birch sees limited use in landscape plantings, partly because it may be relatively hard to locate at local nurseries. It is a good lawn tree, providing relatively light shade, and it has showy bark and fall

foliage colors. It also is a good edge tree for naturalized areas. Although yellow birch grows best in full sun, cherry birch is better suited to hotter or drier sites.

Public Domain

USDA NRCS National Plant Data Center & Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Betula alleghaniensis


Betula alleghaniensis (Yellow Birch), is a species of birch native to eastern North America, from Newfoundland to Nova Scotia, New Brunswick, southern Quebec and Ontario, and the southeast corner of Manitoba in Canada, west to Minnesota, and south in the Appalachian Mountains to northern Georgia.

Yellow Birch bark

It is a medium-sized deciduous tree reaching 20 m tall (exceptionally to 30 m) with a trunk up to 80 cm diameter. The bark is smooth, yellow-bronze, flaking in fine horizontal strips, and often with small black marks and scars. The twigs, when scraped, have a slight scent of oil of wintergreen, though not as strongly so as the related Sweet Birch. The leaves are alternate, ovate, 6-12 cm long and 4-9 cm broad, with a finely serrated margin. The flowers are wind-pollinated catkins 3-6 cm long, the male catkins pendulous, the female catkins erect. The fruit, mature in fall, is composed of numerous tiny winged seeds packed between the catkin bracts.

Betula alleghaniensis is the provincial tree of Quebec, where it is commonly called merisier, a name which in France is used for the wild cherry.

The name "yellow birch" reflects the color of the tree's bark.[1]

The wood of Betula alleghaniensis is extensively used for flooring, cabinetry and toothpicks. Most wood sold as birch in North America is from this tree. Several species of Lepidoptera use the species as a food plant for their caterpillars. See the list of Lepidoptera that feed on birches.

Natural range

References

  1. ^ http://landscaping.about.com/cs/fallfoliagetrees/a/fall_foliage4.htm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Notes

Comments

Betula alleghaniensis is a characteristic tree of the northern Appalachians and the hemlock hardwoods forest of the Great Lakes region. It was formerly widely known by the illegitimate (superfluous) name B . lutea F. Michaux. 

 Native Americans used Betula alleghaniensis medicinally as an emetic or cathartic, to remove bile from intestines, as a blood purifier, as a wash for "Italian itch," and as a diuretic (D. E. Moerman, as Betula lutea ).

Betula alleghaniensis is very closely related to B . lenta , which it resembles in many features (T. L. Sharik and R. H. Ford 1984). A distinctive feature is usually its freely exfoliating bark, although in certain populations the bark remains close and dark (B. P. Dancik 1969; B. P. Dancik and B. V. Barnes 1971).

Betula alleghaniensis Britton × B . papyrifera Marshall has seldom been reported, but it may actually be more common than realized in the northeastern states. In most features it is intermediate between the parents (B. V. Barnes et al. 1974).

Betula × purpusii Schneider (= Betula alleghaniensis Britton × B . pumila Linnaeus, 2 n = 70) is a rather common hybrid wherever the parent species occur together. The large shrubby plants show strikingly intermediate leaf characteristics.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!