Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:403Public Records:147
Specimens with Sequences:401Public Species:10
Specimens with Barcodes:396Public BINs:18
Species:13         
Species With Barcodes:13         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Agelenopsis n. sp. NAA-2005

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGTGCTTGGTCTGCAATAGTAGGAACAGCAATAAGAGTTTTGATTCGGATTGAATTAGGTCAACCTGGGAGATATTTGGGTGAT---GACCATCTTTATAATGTTATTGTTACTGCTCATGCTTTTGTAATGATTTTTTTTATAGTGATGCCTATTTTAATTGGAGGTTTTGGTAATTGGTTGGTGCCTTTGATGTTGGGAGCTCCTGATATGGCGTTTCCTCGTATGAATAATTTAAGATTTTGATTATTACCACCTTCTTTATTTTTATTGTTTATTTCTTCTATGGCTGAAATAGGTGTTGGTGCGGGTTGGACTGTTTATCCTCCTTTAGCTTCTACTGTTGGTCATGCTGGAAGTTCGGTAGATTTTGCTATTTTTTCTTTACATTTAGCGGGAGCTTCTTCTATTATAGGGGCTATTAATTTTATTTCTACTATTTTTAATATACGTTCTTATGGAATGTCAATGGAAAAAGTTCCATTATTTGTGTGGTCAGTTTTAATTACAGCTGTATTATTATTATTATCTTTGCCTGTATTGGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTTAATACGTCTTTCTTTGATCCAGCGGGAGGTGGGGATCCTATTTTATTTCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Agelenopsis n. sp. NAA-2005

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Agelenopsis

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Grass spider

The American grass spiders are members of the genus Agelenopsis. They weave sheet webs that have a funnel shelter on one edge. The web is not sticky, but these spiders make up for that shortcoming by running very rapidly. The larger specimens (depending on species) can get up to approximately 19 mm in body length. They may be recognized by the arrangement of their eight eyes into three rows. The top row has two eyes, the middle row has four eyes, and the bottom row has two eyes (spaced wider than the ones on the top row). They also have two prominent hind spinnerets, and somewhat indistinct bands on their legs. They also have two dark bands running down either side of the cephalothorax.

Agelenopsis aperta, the American funnel-web spider, produces agatoxins. Their bite causes rapid paralysis in insect prey, although the spider's Chelicerae are too small to penetrate human skin.

Name[edit]

The genus name is a combination of Agelena (Eurasian grass spiders) a genus of similar spiders, and Greek -opsis "to look like". They are harmless spiders. Although most spiders use their webs to catch prey, the grass spider's web lacks adhesive ability. The spiders make up for that with their fast running.

The main distinction between Agelenopsis and its European cousin genus Agelena consists of the pattern appearing on the cephalothorax: the former possess two quasi-parallel lines from the eyes to the beginning of the abdomen. The latter ones have lines that are curved, irregular and often meet at the end. Another difference is the length of the front legs row in females, however, in males the comparison is too inconsiderable.

Species[edit]

Other pictures[edit]

References[edit]

See also[edit]

Funnel-Web Spider

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!