Molecular Biology and Genetics

Molecular Biology

Barcode data: Agelenopsis n. sp. NAA-2005

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGTGCTTGGTCTGCAATAGTAGGAACAGCAATAAGAGTTTTGATTCGGATTGAATTAGGTCAACCTGGGAGATATTTGGGTGAT---GACCATCTTTATAATGTTATTGTTACTGCTCATGCTTTTGTAATGATTTTTTTTATAGTGATGCCTATTTTAATTGGAGGTTTTGGTAATTGGTTGGTGCCTTTGATGTTGGGAGCTCCTGATATGGCGTTTCCTCGTATGAATAATTTAAGATTTTGATTATTACCACCTTCTTTATTTTTATTGTTTATTTCTTCTATGGCTGAAATAGGTGTTGGTGCGGGTTGGACTGTTTATCCTCCTTTAGCTTCTACTGTTGGTCATGCTGGAAGTTCGGTAGATTTTGCTATTTTTTCTTTACATTTAGCGGGAGCTTCTTCTATTATAGGGGCTATTAATTTTATTTCTACTATTTTTAATATACGTTCTTATGGAATGTCAATGGAAAAAGTTCCATTATTTGTGTGGTCAGTTTTAATTACAGCTGTATTATTATTATTATCTTTGCCTGTATTGGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTTAATACGTCTTTCTTTGATCCAGCGGGAGGTGGGGATCCTATTTTATTTCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Agelenopsis n. sp. NAA-2005

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:255Public Records:131
Specimens with Sequences:254Public Species:13
Specimens with Barcodes:249Public BINs:16
Species:13         
Species With Barcodes:13         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Agelenopsis

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grass spider

The American grass spiders are members of the genus Agelenopsis. They weave sheet webs that have a funnel shelter on one edge. The web is not sticky, but these spiders make up for that shortcoming by running very rapidly. They may be recognized by the arrangement of their eight eyes into three rows. The larger specimens (depending on species) can get up to approximately 19 mm in body length. The top row has two eyes, the middle row has four eyes, and the bottom row has two eyes (spaced wider than the ones on the top row). They also have two prominent hind spinnerets, and somewhat indistinct bands on their legs. They also have two dark bands running down either side of the cephalothorax.

Agelenopsis aperta, the American funnel-web spider, produces agatoxins. Their bite causes rapid paralysis in insect prey, although the spider's Chelicerae are too small to penetrate human skin.

Contents

Name [edit]

The genus name is a combination of Agelena (Eurasian grass spiders) a genus of similar spiders, and Greek -opsis "to look like". They are harmless spiders. Although most spiders use their webs to catch prey, the grass spider's web lacks adhesive ability. The spiders make up for that with their fast running.

Species [edit]

Other pictures [edit]

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!