Overview

Comprehensive Description

Biology: Nematocysts

More info
LocationImageCnidae TypeRange of
Lengths (m)
Range of
Widths (m)
nNState
Hand C. H., 1955
Actinopharynx
basitrichs  57 - 94  x  5 - 7  94 / Unfired
Column
basitrichs  17 - 28  x  2 - 3  78 / Unfired
Filaments
basitrichs  10 - 22  x  2 - 3  71 / Unfired
basitrichs  43 - 76  x  5 - 6  67 / Unfired
microbasic p-mastigophores  27.5 - 56  x  6 - 7  68 / Unfired
microbasic p-mastigophores  20 - 35  x  4.5 - 6  80 / Unfired
Tentacles
basitrichs  15.5 - 29  x  2 - 3  63 / Unfired
spirocysts  24 - 58  x  3 - 4  55 / Unfired
Song J. I. and Cha H. R., 2002
Actinopharynx
N/A basitrichs  14 - 24  x  2.5 - 4  /
N/A basitrichs  31 - 66  x  4 - 6  /
N/A basitrichs  96.5 - 98.8  x  4 - 5.5  /
N/A spirocysts  23 - 46  x  3.5 - 6  /
Column
N/A basitrichs  19 - 29  x  2.5 - 4  /
N/A spirocysts  23 - 25.5  x  2.5 - 3  /
Filaments
N/A basitrichs  13 - 29  x  2.5 - 4  /
N/A basitrichs  93.2 - 98  x  3.8 - 4.8  /
N/A basitrichs  35 - 63  x  3.8 - 4.8  /
N/A microbasic p-mastigophores  24 - 36.5  x  6 - 7  /
N/A spirocysts  21 - 29  x  3.5 - 4  /
Tentacles
N/A basitrichs  19.5 - 27.4  x  2.5 - 4  /
N/A basitrichs  46 - 66  x  4 - 5  /
N/A spirocysts  29 - 53  x  4 - 5  /
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology/Natural History: Feeds on crabs, urchins, mussels, gastropods, chitons, barnacles, and fish. May feed on stranded jellyfish. The candy-striped shrimp Lebbeus grandimanus is a commensal, immune to the sting. Sexes are separate. In CA and the East Coast fertilization is internal, by sperm which drift in the currents. Eggs are .5 to .7 mm in diameter. The female releases the young as small but fully formed juveniles. In Puget Sound both eggs and sperm are released into the water, and the settling larvae settle preferentially on soft tubeworm tubes. Young grow to 0.3 cm diameter the first year, may mature by 1-1.5 cm diameter. Live 60-80 years. Young are seldom seen.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This large, common intertidal anemone has small tubercles on the column wall but no acontia. The tubercles are not white and usually do not accumulate material like gravel or shell. The column is variable in color, often being blotched red and green but may be greenish, olive, brownish, or red. The tentacles are usually cross-banded and end with a blunt tip. The oral disk has no radiating white stripes. Diameter to about 20 cm and height to 30 cm. Frequently seen stretched out and drooping from the rock at low tide.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, European waters (ERMS scope), Gulf of St. Lawrence, Northern North Atlantic, Northern North Pacific, Saguenay Fjord, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Alaska to S CA (uncommon in CA). Also in Europe and eastern Canada, Maine. Circumpolar.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: This is the most common intertidal Urticina found around Rosario. Urticina piscivora has no transverse bands on the tentacles and the column is usually a solid bright red, plus it is subtidal. Several other Urticina species either have white tubercles or accumulate bits of sand, gravel, and shell on the tubercles. The most similar species, found in similar habitats, is Urticina coriacea, which has a solid red column and accumulates sand on its tubercles. Cribrinopsis fernaldi has similar colors but the bands on its tentacles are narrow and zigzag and there are radiating red lines on the oral disk.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 76 specimens in 1 taxon.
Water temperature and chemistry ranges based on 54 samples.

Environmental ranges
  Depth range (m): 0 - 377
  Temperature range (°C): -0.077 - 9.458
  Nitrate (umol/L): 0.916 - 33.078
  Salinity (PPS): 31.635 - 34.981
  Oxygen (ml/l): 3.850 - 7.426
  Phosphate (umol/l): 0.273 - 2.547
  Silicate (umol/l): 1.963 - 73.441

Graphical representation

Depth range (m): 0 - 377

Temperature range (°C): -0.077 - 9.458

Nitrate (umol/L): 0.916 - 33.078

Salinity (PPS): 31.635 - 34.981

Oxygen (ml/l): 3.850 - 7.426

Phosphate (umol/l): 0.273 - 2.547

Silicate (umol/l): 1.963 - 73.441
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Low intertidal to 30 m.

Habitat: Often below or hanging from the underside of boulders.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Benthic Community

 

The species associated with this article partially comprise the benthic community of Stellwagen Bank, an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachusetts. Protected since 1993 as part of the Stellwagen Bank National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

The benthic community of Stellwagen Bank is diverse and varied, depending largely on the grain size of the substrate. Sessile organisms such as bryozoans, ascidians, tunicates, sponges, and tube worms prefer gravelly and rocky bottoms, while burrowing worms, burrowing anemones, and many mollusks prefer sand or mud surfaces (NOAA 2010). Macroalgae, such as kelps, are exceedingly rare in the area — most biogenic structure along the bottom is provided by sponges, cnidarians, and worms. The dominant phyla of the regional benthos are Annelida, Mollusca, Arthropoda, and Echinodermata (NOAA 2010). 

Ecologically, the Stellwagen Bank benthos contributes a number of functions to the wider ecosystem. Biogenic structure provided by sessile benthic organisms is critical for the survivorship of juveniles of many fish species, including flounders, hake, and Atlantic cod. The benthic community includes a greater than average proportion of detritivores — many crabs and filter-feeding mollusks — recycling debris which descends from the water column above (NOAA 2010). Finally, the organisms of the sea-bed are an important source of food for many free-swimming organisms. Creatures as large as the hump-backed whale rely on the benthos for food — either catching organisms off the surface or, in the whale’s case, stirring up and feeding on organisms which burrow in sandy bottoms (Hain et al 1995). 

As a U.S. National Marine Sanctuary, Stellwagen Bank is nominally protected from dredging, dumping, major external sources of pollution, and extraction of mammals, birds or reptiles (Eldredge 1993). The benthic habitat remains threatened, however, by destructive trawling practices. Trawl nets are often weighted in order that they be held against the bottom, flattening soft surfaces, destroying biogenic structure, and killing large numbers of benthic organisms. There is also occasional threat from contaminated sediments dredged from Boston harbor and deposited elsewhere in the region (NOAA 2010). The region benefits from close observation by NOAA and the Woods Hole Oceanographic Institute, however, and NOAA did not feel the need to make any special recommendations for the preservation of benthic communities in their 2010 Management Plan and Environmental Assessment. 

  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Hain JHW, Ellis SL, Kenney RD, Clapham PJ, Gray BK, Weinrich MT, Babb IG. 1995. Apparent bottom feeding by humpback-whales on Stellwagen Bank. Marine Mammal Science 11, 4:464-479.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Appendix J: Preliminary Species List for the SBNMS” pp. 370-381. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Urticina crassicornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGAATAGGATCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAATTATCTGCCCCTGGTACTATGTTGGGGGAT---GACCATCTTTATAATGTCATAGTGACGGCACACGCCTTTATTATGATTTTCTTCCTAGTAATGCCAGTAATGATAGGAGGGTTTGGTAATTGGTTGGTACCACTATACATTGGTGCCCCCGATATGGCCTTCCCACGACTAAACAATATTAGTTTTTGGCTACTTCCTCCCGCGCTTATACTATTACTAGGTTCTGCCTTTGTTGAGCAAGGAGTGGGAACAGGGTGGACGGTATACCCTCCTCTATCCGGCATTCAAACGCACTCGGGAGGGGCGGTCGACATGGCCATCTTTAGCCTTCATTTAGCGGGTGCGTCTTCTATATTAGGGGCAATGAATTTTATAACAACCATATTTAATATGAGAGCACCGGGATTAACGATGGATAGACTCCCGCTATTTGTGTGGTCCATTTTAATTACTGCCTTTTTATTATTACTCTCCCTACCAGTCTTAGCAGGTGGAATAACCATGCTTTTAACAGATAGGAATTTTAATACAACTTTCTTTGACCCAGCAGGAGGTGGAGATCCCATCTTATTCCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Urticina crassicornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!