Overview

Comprehensive Description

Biology: Nematocysts

More info
LocationImageCnidae TypeRange of
Lengths (m)
Range of
Widths (m)
nNState
Hand C. H., 1955
Actinopharynx
basitrichs  57 - 94  x  5 - 7  94 / Unfired
Column
basitrichs  17 - 28  x  2 - 3  78 / Unfired
Filaments
basitrichs  10 - 22  x  2 - 3  71 / Unfired
basitrichs  43 - 76  x  5 - 6  67 / Unfired
microbasic p-mastigophores  27.5 - 56  x  6 - 7  68 / Unfired
microbasic p-mastigophores  20 - 35  x  4.5 - 6  80 / Unfired
Tentacles
basitrichs  15.5 - 29  x  2 - 3  63 / Unfired
spirocysts  24 - 58  x  3 - 4  55 / Unfired
Song J. I. and Cha H. R., 2002
Actinopharynx
N/A basitrichs  14 - 24  x  2.5 - 4  /
N/A basitrichs  31 - 66  x  4 - 6  /
N/A basitrichs  96.5 - 98.8  x  4 - 5.5  /
N/A spirocysts  23 - 46  x  3.5 - 6  /
Column
N/A basitrichs  19 - 29  x  2.5 - 4  /
N/A spirocysts  23 - 25.5  x  2.5 - 3  /
Filaments
N/A basitrichs  13 - 29  x  2.5 - 4  /
N/A basitrichs  93.2 - 98  x  3.8 - 4.8  /
N/A basitrichs  35 - 63  x  3.8 - 4.8  /
N/A microbasic p-mastigophores  24 - 36.5  x  6 - 7  /
N/A spirocysts  21 - 29  x  3.5 - 4  /
Tentacles
N/A basitrichs  19.5 - 27.4  x  2.5 - 4  /
N/A basitrichs  46 - 66  x  4 - 5  /
N/A spirocysts  29 - 53  x  4 - 5  /
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology/Natural History: Feeds on crabs, urchins, mussels, gastropods, chitons, barnacles, and fish. May feed on stranded jellyfish. The candy-striped shrimp Lebbeus grandimanus is a commensal, immune to the sting. Sexes are separate. In CA and the East Coast fertilization is internal, by sperm which drift in the currents. Eggs are .5 to .7 mm in diameter. The female releases the young as small but fully formed juveniles. In Puget Sound both eggs and sperm are released into the water, and the settling larvae settle preferentially on soft tubeworm tubes. Young grow to 0.3 cm diameter the first year, may mature by 1-1.5 cm diameter. Live 60-80 years. Young are seldom seen.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This large, common intertidal anemone has small tubercles on the column wall but no acontia. The tubercles are not white and usually do not accumulate material like gravel or shell. The column is variable in color, often being blotched red and green but may be greenish, olive, brownish, or red. The tentacles are usually cross-banded and end with a blunt tip. The oral disk has no radiating white stripes. Diameter to about 20 cm and height to 30 cm. Frequently seen stretched out and drooping from the rock at low tide.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Alaska to S CA (uncommon in CA). Also in Europe and eastern Canada, Maine. Circumpolar.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: This is the most common intertidal Urticina found around Rosario. Urticina piscivora has no transverse bands on the tentacles and the column is usually a solid bright red, plus it is subtidal. Several other Urticina species either have white tubercles or accumulate bits of sand, gravel, and shell on the tubercles. The most similar species, found in similar habitats, is Urticina coriacea, which has a solid red column and accumulates sand on its tubercles. Cribrinopsis fernaldi has similar colors but the bands on its tentacles are narrow and zigzag and there are radiating red lines on the oral disk.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 76 specimens in 1 taxon.
Water temperature and chemistry ranges based on 54 samples.

Environmental ranges
  Depth range (m): 0 - 377
  Temperature range (°C): -0.077 - 9.458
  Nitrate (umol/L): 0.916 - 33.078
  Salinity (PPS): 31.635 - 34.981
  Oxygen (ml/l): 3.850 - 7.426
  Phosphate (umol/l): 0.273 - 2.547
  Silicate (umol/l): 1.963 - 73.441

Graphical representation

Depth range (m): 0 - 377

Temperature range (°C): -0.077 - 9.458

Nitrate (umol/L): 0.916 - 33.078

Salinity (PPS): 31.635 - 34.981

Oxygen (ml/l): 3.850 - 7.426

Phosphate (umol/l): 0.273 - 2.547

Silicate (umol/l): 1.963 - 73.441
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Low intertidal to 30 m.

Habitat: Often below or hanging from the underside of boulders.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stellwagen Bank Benthic Community

 

The species associated with this article partially comprise the benthic community of Stellwagen Bank, an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachusetts. Protected since 1993 as part of the Stellwagen Bank National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

The benthic community of Stellwagen Bank is diverse and varied, depending largely on the grain size of the substrate. Sessile organisms such as bryozoans, ascidians, tunicates, sponges, and tube worms prefer gravelly and rocky bottoms, while burrowing worms, burrowing anemones, and many mollusks prefer sand or mud surfaces (NOAA 2010). Macroalgae, such as kelps, are exceedingly rare in the area — most biogenic structure along the bottom is provided by sponges, cnidarians, and worms. The dominant phyla of the regional benthos are Annelida, Mollusca, Arthropoda, and Echinodermata (NOAA 2010). 

Ecologically, the Stellwagen Bank benthos contributes a number of functions to the wider ecosystem. Biogenic structure provided by sessile benthic organisms is critical for the survivorship of juveniles of many fish species, including flounders, hake, and Atlantic cod. The benthic community includes a greater than average proportion of detritivores — many crabs and filter-feeding mollusks — recycling debris which descends from the water column above (NOAA 2010). Finally, the organisms of the sea-bed are an important source of food for many free-swimming organisms. Creatures as large as the hump-backed whale rely on the benthos for food — either catching organisms off the surface or, in the whale’s case, stirring up and feeding on organisms which burrow in sandy bottoms (Hain et al 1995). 

As a U.S. National Marine Sanctuary, Stellwagen Bank is nominally protected from dredging, dumping, major external sources of pollution, and extraction of mammals, birds or reptiles (Eldredge 1993). The benthic habitat remains threatened, however, by destructive trawling practices. Trawl nets are often weighted in order that they be held against the bottom, flattening soft surfaces, destroying biogenic structure, and killing large numbers of benthic organisms. There is also occasional threat from contaminated sediments dredged from Boston harbor and deposited elsewhere in the region (NOAA 2010). The region benefits from close observation by NOAA and the Woods Hole Oceanographic Institute, however, and NOAA did not feel the need to make any special recommendations for the preservation of benthic communities in their 2010 Management Plan and Environmental Assessment. 

  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Hain JHW, Ellis SL, Kenney RD, Clapham PJ, Gray BK, Weinrich MT, Babb IG. 1995. Apparent bottom feeding by humpback-whales on Stellwagen Bank. Marine Mammal Science 11, 4:464-479.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Appendix J: Preliminary Species List for the SBNMS” pp. 370-381. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Urticina crassicornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTTGGAATAGGATCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAATTATCTGCCCCTGGTACTATGTTGGGGGAT---GACCATCTTTATAATGTCATAGTGACGGCACACGCCTTTATTATGATTTTCTTCCTAGTAATGCCAGTAATGATAGGAGGGTTTGGTAATTGGTTGGTACCACTATACATTGGTGCCCCCGATATGGCCTTCCCACGACTAAACAATATTAGTTTTTGGCTACTTCCTCCCGCGCTTATACTATTACTAGGTTCTGCCTTTGTTGAGCAAGGAGTGGGAACAGGGTGGACGGTATACCCTCCTCTATCCGGCATTCAAACGCACTCGGGAGGGGCGGTCGACATGGCCATCTTTAGCCTTCATTTAGCGGGTGCGTCTTCTATATTAGGGGCAATGAATTTTATAACAACCATATTTAATATGAGAGCACCGGGATTAACGATGGATAGACTCCCGCTATTTGTGTGGTCCATTTTAATTACTGCCTTTTTATTATTACTCTCCCTACCAGTCTTAGCAGGTGGAATAACCATGCTTTTAACAGATAGGAATTTTAATACAACTTTCTTTGACCCAGCAGGAGGTGGAGATCCCATCTTATTCCAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Urticina crassicornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Urticina crassicornis

Urticina crassicornis is a large and common intertidal and subtidal sea anemone formerly known as Tealia crassicornis and commonly referred to as the Christmas Anemone. Its habitat includes a large portion of global coastal areas and it lives a solitary life for up to 80 years of age.[1]

Description[edit]

Urticina crassicornis is biradially symmetrical and ranges from 2 - 12.7 cm tall with a width of 1 - 7.6 cm. This sea anemone has a solid basal plate which is always flat. Its column can be olive green with or without red spots; solid red; cream; or brown, always with small, inconspicuous tubercles but no acontia. Its tubercles are not white and do not usually accumulate bits of sand, gravel and shell. The tentacles, superior of the column and usually 100 in number, are green to opaque cream with red and white striations and semi-transparent when extended. The tentacles are conical, thick and blunt and arranged in 3 - 5 circular rings around the oral disc. The oral disc has no white striations and usually has the same color scheme as the tentacles.[1][2]

Geographical range and habitat[edit]

Urticina crassicornis habitat.jpg

In the Pacific Ocean, Urticina crassicornis ranges from intertidal and subtidal zones of the Pribilof Islands, Alaska to Monterey, California. In the Atlantic Ocean, it is found in intertidal and subtidal zones ranging from the Arctic Ocean above Newfoundland, Canada to Cape Cod, Massachusetts and also along the coasts of Western Europe. In the state of Washington this sea anemone more commonly frequents the Puget Sound compared to the Pacific Ocean front. It is found in a lower intertidal, upper subtidal zone - 30 m deep, inhabiting well protected and shaded areas. Urticina crassicornis is a benthic and sessile organism, firmly attached only to hard substrata. This sea anemone is frequently found on docks, wood pilings, and under large rock outcroppings.[1]

Feeding[edit]

A non-selective and opportunistic predator, Urticina crassicornis, may feed on crabs, sea urchins, mussels, gastropods, chitons, barnacles, fish, and sometimes sea stars and stranded jellies. A peculiar prey, the sun star, Pycnopodia helianthoides commonly known as the "Sunflower Star", is found in Washington state and has a size much greater than U. crassicornis, sometimes ranging up to 5 ft. in length.[3] This anemone exhibits both intracellular and extracellular digestion. Food is caught within the tentacles which then move the prey towards the oral disc.[2][4]

Predators, parasites, and protection[edit]

In the Pacific, certain species of both Asteroidea and Gastropoda are known predators of this anemone. Demasterias imbricata (Asteroidea) and Aeolidia papillosa (Gastropoda) are two notably frequent predator species. Urticina crassicornis senses predation through a simple nerve net spanning along its column and tentacle walls. For protection, U. crassicornis inverts its tentacles to the inside of its body column and projects nematocysts. Minimal locomotion is possible if the organism is sensing extreme danger. Some species of amphipods are parasites of U. crassicornis living within its body cavity for the benefits of housing and food. These species are not affected by the nematocysts of U. crassicornis, which has the ability to kill other species of crustacean.[5][6]

Reproduction[edit]

Urticina crassicornis produces by both asexual and sexual reproduction. In the Atlantic populations, eggs and sperm are held and fertilized within the body column. The young are brooded between the mesenteries of the body and are emitted as smallish, well developed, young anemones. Spawning occurs in the spring amongst Puget Sound populations, when eggs (yolky, 0.7 mm in diameter) and sperm are released into the sea for fertilization. Urticina crassicornis's major sperm chromosomal proteins have been found to be two specialized histone H1 proteins which indicate a strong relation to the chromosomal proteins of bird and amphibians.[7] After fertilization, a solid and ciliated blastula is created due to superficial cleavage. Six days following fertilization, a cone-shaped and benthic, larval planula develops. These planula then settle onto small rocks or the empty tubes of some annelid worms and rapidly develop into small anemones. 12 days after settlement, 8 tentacles appear. Further growth is slow – two months after settlement, 12 tentacles appear and the anemone is 0.88 mm in diameter; one year after settlement, the anemone has 35 tentacles and is 10 mm in diameter. Growth is proportional to food intake, not age. When starved, this anemone can stay alive for 9 months but does not grow. Urticina crassicornis is sexually mature with a diameter of 10 – 15 mm, being at least one year old.[1]

Footnotes[edit]

  1. ^ a b c d Abbot, Donald P., Hadderlie, Eugene C., Morris, Robbert H. Intertidal Invertebrates of California. Stanford, CA: Stanford University Press, 1980.
  2. ^ a b Cowles, David. Urticina Crassicornis. Walla-Walla, WA: 2005.
  3. ^ Markovich, Karlee. Urticina crassicornis. Juneau, AK: University of Alaska Southeast, 2002.
  4. ^ Kozloff, Eugene N. Marine Invertebrates of the Pacific Northwest. Seattle, WA: University of Washington Press, 1996.
  5. ^ Nybakken, James W. Diversity of the Invertebrates. Dubuque, IA: Times Mirror Higher Education Group, Inc., 1996.
  6. ^ Verill, A.E. On the Parasitic Habits of Crustacea. Chicago, IL: The University of Chicago Press, 1869.
  7. ^ Ausio, Juan, Rocchini, Corinne, Zhang, Fan. Two Specialized Histone H1 proteins are the major sperm of the sea anemone Urticina (Tealia) crassicornis. Victoria, BC: Department of Biochemistry and Microbiology, University of Victoria, 1995

References[edit]

  1. Nybakken, James W. Diversity of the Invertebrates. Dubuque, IA: Times Mirror Higher Education Group, Inc., 1996.
  2. Abbot, Donald P., Hadderlie, Eugene C., Morris, Robbert H. Intertidal Invertebrates of California. Stanford, CA: Stanford University Press, 1980.
  3. Kozloff, Eugene N. Marine Inveretebrates of the Pacific Northwest. Seattle, WA: University of Washington Press, 1996.
  4. Cowles, David. Urticina crassicornis. Walla-Walla, WA: Walla-Walla University, 2005.
  5. Ausio, Juan, Rocchini, Corinne, Zhang, Fan. Two Specialized Histone H1 proteins are the major sperm of the sea anemone Urticina (Tealia) crassicornis. Victoria, BC: Department of Biochemistry and Microbiology, University of Victoria, 1995
  6. Chia, Fu-Shiang, Spaulding, James G. Development and Juvenile growth of the sea anemone, Tealia Crassicornis. Marine Biological Laboratory, 1972.
  7. Verill, A.E. On the Parasitic Habits of Crustacea. Chicago, IL: The University of Chicago Press, 1869.
  8. Markovich, Karlee. Urticina crassicornis. Juneau, AK: University of Alaska Southeast, 2002.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!