Overview

Comprehensive Description

Orectolobus hutchinsinew species

(Figs 1-7, Table 1)

Orectolobus sp. : Hutchins and Thompson, 1983, pp 10, 73, fig. 10.

Orectolobus sp. : Hutchins and Swainston, 1986, pp 20, 119, fig. 12.

Orectolobus sp. A : Last and Stevens, 1994, pp 126, 128-9, fig. 14.2, Pl. 26; Compagno, 2001, pp 154, 161-2, figs 117, 125; Compagno, et al., 2005, p 164, Pl. 24.

Holotype . CSIRO H 5275-01, 1325 mm TL, mature male, north of Rottnest Island, Western Australia , 31° 55'S , 115° 27'E , caught by demersal gillnet, 39 m depth, 19 Dec. 1999 .

Paratypes . Twelve specimens. CSIRO H 6189-01, 1099 mm TL, female , CSIRO H 6189-02, 921 mm TL, immature male , CSIRO H 6189-03, 1005 mm TL, immature male, west of Green Head, Western Australia , 30° 00'S , 114° 32'E , caught by demersal gillnet, 79 m depth, 15 Oct. 2004 ; WAM P 4736-001, 2 specimens, 234 mm TL, juvenile female, 236 mm TL, juvenile male, Stony Island, Albany, Western Australia , 35° 02'S , 117°38'E , 28 Oct. 1959 ; WAM P 6702-001, 200 mm TL, late male embryo, WAM P 6704-001, 202 mm TL, late female embryo, Shark Bay, Western Australia , 25°21'S , 113°40'E , Sept. 1960 ; WAM P 12021-001, 576 mm, immature male, Point Peron, Western Australia , 32°15'S , 115°40'E , caught by line ; WAM P 27880-001, two specimens 246 mm TL, juvenile male, 341 mm TL, juvenile female, Bunkers Bay, Western Australia , 33°32'S , 115°02'E , caught by rotenone, 0.1 to 5 m depth, 8 Dec. 1982 ; WAM P 26620-001, 369 mm TL, female; Geordie Bay, Rottnest Island, Western Australia , 32°00'S , 115°30'E , caught by rotenone, 5 m depth ; WAM P 27731-001, 905 mm TL, male, Ocean Reef, Western Australia , 31°47'S , 115°38'E , caught by fishing line .

Diagnosis. A moderate-sized, Orectolobus with the following: yellowish brown when fresh with well-defined, darker brown saddles; no white spots, blotches or reticulations on fins or body; nasal barbel distinctly bilobed; postspiracular lobes simple, reduced or rudimentary; distance across preorbital lobe group 1.2-1.3 times interspace between preorbital group and postspiracular lobe, 13-15 times base length of anterior postspiracular lobe; base of anterior postspiracular lobe 11-12 in its distance from postorbital group, 4.9-7 in its distance from posterior postspiracular lobe; mouth width 4.7-10.2 times preoral distance; no warty tubercles on back of adult; juveniles with rows of elevated denticles or poorly defined warty tubercles on back; dorsal fins raked posteriorly; first dorsal fin over rear half of pelvic-fin bases; interdorsal space 0.38-0.56 times anal-fin base length; anal-fin inner margin 0.8-1.1 times anal-fin posterior margin; teeth in upper jaw 25-27, those in medial row at symphysis rudimentary; spiral valve turns 26-28; monospondylous centra 48-50.

Description. Body firm, moderately depressed anteriorly from snout to pelvic-fin origin; broadest over midtrunk, trunk width 18.5% in holotype (15.2-17.6% in adult paratypes, 12.2-16.3% in postnatal juvenile paratypes) TL. Head broad, strongly depressed, somewhat oval in cross-section, length 21.7 (21.7-23.0)% TL; maximum height 9.3 (5.6-9.7)% TL, length 0.88 (0.70-0.86) in pectoral-pelvic space; pelvic-anal space 2.69 (1.86-3.42) times anal-fin base; snout-vent length 1.00 (0.81-1.01) tail length. Tail subcircular anteriorly in adults, more compressed in juveniles, its width 1.04 (0.99- 1.02, 1.26-1.27 in juveniles) in height at second dorsal-fin insertion; caudal peduncle rudimentary, caudal fin almost connected to anal-fin insertion, compressed slightly, oval in cross section, width 1.43 (1.09-1.57) in height.

Snout short, narrowly rounded in lateral view, almost truncate to broadly rounded in dorsal view, apex indented slightly; preoral length 1.4 (1.0-2.0)% TL, 6.6 (4.4-10.2) in mouth width; prenarial length negligible. Eyes dorsal on head, small, slit-like, length 1.7 (1.4-1.9)% TL, 12.6 (11.8-15.5) in head length; supraorbital crest elevated slightly over and eye and above spiracle; interorbit flat to weakly concave, space 3.61 (3.51-4.80) times eye length, 1.25 (1.07-1.50) times preorbit, 2.39 (2.18-2.67) times spiracle length, 0.87 (0.71-1.04) in prespiracular length; subocular pocket deep, well-developed, curved ventrally. Spiracles narrow, slit-like, oblique to horizontal axis, slightly longer than eye, 1.51 (1.43-2.01) times eye length; their dorsal margin strongly concave, well elevated above weakly concave ventral margin; eye-spiracle space relatively large, 1.8 (1.5-1.9)% TL; weak groove above dorsal margin of spiracle; short, deep, transverse groove near posterior edge of spiracle. Gill slits lateral on head; anterior four slits more or less equally spaced, of similar height 1.8-2 (1.1-2.1)% TL; 5th gill slit tallest, 1.33 (1.25-1.97) times 4th; 4th closer to 5th than to 3rd; 2nd directly above pectoral-fin origin, 5th slightly anterior to midbase of pectoral fin. Mouth subterminal, large, horizontally expanded, broadly arched; width 9 (8.5-10.4)% TL, 3.2-5.8 times its length in paratypes (length in holotype damaged), 1.77 (1.43-2.05) in head width at eye; mouth length of paratypes 1.8-2.8% TL; upper labial furrows 3.6 (3.5-4.3)% TL, originating at ventral margin of nostrils; lower labial furrows longer than uppers, their length 4.8 (4.3-5.4)% TL, 0.53 (0.42-0.63) of mouth width, almost connected near symphysis of lower jaw; short, deep longitudinal groove at symphysis of lower jaw. Nostrils small, widely separated, internarial space 4.7 (4.1-5.1)% TL, adjacent upper lip of mouth. Nasal barbel terminal on head, medial to nostrils, proboscis like, rounded basally, tapering distally, length subequal to upper labial furrows; short, flattened lobe at basal third of its posterior margin (less pronounced in juveniles); lateral nasal lobe broad, well elevated, subcircular, most expanded posteriorly.

Teeth not exposed when mouth closed, varying in shape and size in each jaw (Figs 5, 6); cusps mostly directed lingually; some non-symphysial teeth with weak distal cusplet. Upper jaw with 3 rows at symphysis, a single medial row of small teeth with a weak cusp, flanked on each side by a row of very large, fang-like teeth; lateral symphysial rows with long cusps, in three functional series, labial cusps well anterior, more upright and partly recessed into upper lip; rows distal to symphysis with teeth decreasing sequentially in size, anterior teeth with long cusps, near angle of jaw cusps very short, indistinct. Lower jaw with three rows of enlarged symphysial teeth, their cusps subequal in length to each other and to those at symphysis of upper jaw; tooth cusps distal to symphysis decreasing sequentially in size more sharply than in upper jaw; cusps rudimentary near angle. Tooth formula (holotype, 3 paratypes): upper jaw 12 (12-13) + 1 (1) + 12 (12-13) = 25 (25-27); lower jaw 10 (10-11) + 1 (1) + 9 (10-11) = 20 (21-23).

Dermal lobes poorly developed; anterior preorbital group (PO1) with two, simple lobes, first lobe broader based and shorter than second, lobes almost connected; posterior preorbital group (PO2) with two simple lobes, longer, more slender, more widely spaced than anterior group; combined distance across preorbital groups 6.7 (6.3-6.6, 7.2-7.6 in juveniles)% TL; anterior postspiracular group (PS1) with single, short lobe; posterior postspiracular lobe (PS2) rudimentary in holotype, simple, short in paratypes, base width of anterior postspiracular lobe 0.5 (0.4-0.5, 0.7-0.8 in juveniles)% TL, base width of posterior postspiracular lobe 0.3 (0.3, 0.4-0.5 in juveniles)% TL; distance between preorbital group and anterior postspiracular lobe 5.1 (5.3-5.4, 4.4-5.0 in juveniles)% TL, between postspiracular lobes 3.2 (2.4-2.7, 2.2-2.4 in juveniles)% TL.

Dermal denticles (Fig. 7) variable in shape, on dorsal trunk minute, columnar, nonimbricated, compact (juvenile denticles imbricated); crowns of adult usually convex distally, with scalloped or irregular anterior margins, entire posterior margins (juveniles with broad, leaf-shaped crowns); crowns winged or filamentous inside spiracle; skin somewhat velvety; postnatal juveniles with elevated scales, extending in two, irregular longitudinal rows from near spiracle to below second dorsal fin, more elevated in WAM P 4736-001 (female, 236 mm TL) than smaller paratype, WAM P 6702-001 (male, 200 mm TL); weak warty tubercles on back of largest juvenile, WAM P 1202-001 (male, 576 mm TL); holotype and larger paratypes lacking warty tubercles. Clasper elongate, extending to below second dorsal fin; outer length 9.7% TL; inner length 15.9% TL, 4.5 times width at base; glands expanded slightly, tip bluntly pointed.

Dorsal fins similar in size and shape, firm, triangular; anterior and posterior margins straight, equally oblique; apices acute, first dorsal-fin apex not more rounded than second dorsal-fin apex; inner margin parallel originating just forward of level of pelvic-fin rear tip; predorsal length 50.7 (47.5-49.5)% TL, pre-second dorsal-fin length 64.1 (58.5- 62.2)% TL; first dorsal-fin height 7.7 (7.2-9.0)% TL; 1.06 (0.91-1.08) times second dorsal-fin height; first dorsal-fin inner margin 1.26 (1.02-1.5) times spiracle length; first dorsal-fin midpoint to pectoral-fin insertion 27.5 (24.6-28.7)% TL; first dorsal-fin midpoint to pelvic-fin origin 8.5 (8.5-9.4, 10.1-10.2 in juveniles)% TL.

Pectoral fin moderately large, length 14.8 (11.6-14.7)% TL, anterior margin length 3.53 (2.43-4.01) times inner margin length; base fleshy, anterior margin weakly convex, apex narrowly rounded; posterior margin straight distally; inner margin straight, free rear tip very broadly rounded; prepectoral length 18.3 (17.4-20.3)% TL; pectoral-pelvic space 19.1 (15-19.2)% TL.

Pelvic fin subtriangular, of moderate-size, length 14.3 (11.7-13.5)% TL; anterior margin straight; apex very broadly rounded; posterior margin weakly convex; inner margin straight, free rear tip narrowly rounded; origin well anterior to first dorsal-fin origin, insertion below first dorsal-fin midpoint, prepelvic length 46.2 (39.8-45)% TL; pelvic-anal space 20.9 (19.1-22.9)% TL, pelvic-caudal space 26.9 (27-29.2)% TL.

Anal fin obliquely elongate, lobe-like, well developed, base 7.8 (6.7-8.5, 8.1-11.4 in juveniles)% TL, 0.56 (0.24-0.45) in interdorsal distance; anterior and inner margins almost parallel, very broadly rounded at apex; origin well posterior of second dorsal-fin insertion; anal-fin height 2.06 (1.79-2.27, 2.47-4.00 in juveniles) in base length; second dorsal-fin origin to anal-fin origin 12.1 (10.5-12.6)% TL, second dorsal-fin insertion to anal-fin insertion 7.7 (7.6-10)% TL; anal-fin length 3.35 (2.26-5.63) times its posterior margin length; inner margin 0.75 (0.76-1.33) times posterior margin.

Caudal fin moderately elongate, strongly compressed; dorsal caudal margin straight, length 18.5 (18.1-19.6, 19.5-22.8 in juveniles)% TL, its origin slightly anterior to anal-fin insertion; upper lobe originating as a indistinct, low ridge; posterior margin irregular, with rounded apices; terminal caudal lobe fan-like, length 1.75 (1.37-2.02) times spiracle length.

Vertebral counts (n=5 paratypes): monospondylous centra 48-50; precaudal centra 106-109; caudal centra 39-45; total centra 97-105. Spiral valve counts: 26-28 (n=3, based on discarded specimens, validated from photographs).

Coloration. When fresh. Dorsal surface medium brown to yellowish with prominent dark brown blotches and saddles; three predorsal saddles, additional bars beneath each dorsal fin, one bar interdorsally; blotches and saddles strongly demarcated, but not well defined from each other (better defined in juveniles); dark markings spaced irregularly with diffuse edges; predorsal saddles with well-defined, yellowish ocelli; snout finely spotted; no small dark or whitish spots, blotches or reticulations; unpaired fins and upper surfaces of paired fins darkest anteriorly. Ventral surface only slightly paler than rest of body. In preservative. Dorsal coloration becoming greyish to bluish grey; saddles and bars remaining dark, brown to reddish-brown (ginger), strongly demarcated from rest of body; contrast of similar tones on dorsal, caudal, and upper surfaces of pectoral and pelvic fins; mouth white; nasal barbel darker dorsally than ventrally. Ventral surface whitish with dark grey blotches; blotches less dense in paratypes, greyish areas concentrated to lip margins, edge of head, and on pectoral and pelvic fins; tail more uniformly dark than trunk; claspers grey.

Size. This species was first reported by Hutchins and Thompson (1983) and was thought to reach about 152 cm TL. Others have claimed that it matures by 85 cm TL (Last and Stevens, 1994) and attains about 200 cm TL (Hutchins and Swainston, 1986, Compagno, 2001). Unpublished data by one of us (Chidlow) is based on 696 specimens, including mature males. The largest individual observed measured 149 cm TL confirming the initial reports of a smaller maximum size for O. hutchinsi . However, males mature at a slightly larger size than suggested by earlier reports (i.e. about 111 cm TL rather than 85 cm TL). The mature male holotype had a girth of 625 mm and weighed 15 kg. Young are born at 22-26 cm TL (mean 24.1 cm TL based on 40 specimens).

Etymology. Named in honour of Dr Barry Hutchins (curator of fishes at the Western Australian Museum, Perth) who has dedicated a lifetime to the taxonomy of the rich fish fauna of Western Australia. Dr Hutchins first reported this species as an undescribed taxon more than 20 years ago.

Common name. Western Wobbegong.

Distribution. Inshore continental shelf off Western Australia from Groper Bluff (west of Bremer Bay) to Coral Bay (near North West Cape). Types known from 0.1-79 m but additional material collected in depths of 9-106 m.

Comparisons. One of the most distinctive members of the genus Orectolobus based on its colour pattern and dermal lobe morphology, Orectolobus hutchinsi is larger than most wobbegong species. It has a distinctive yellowish brown upper body coloration with welldefined, darker brown saddles containing paler markings (most congeners have stronger and more complex colour patterns) that lacks whitish rings and blotches (unlike O. ornatus and O. maculatus ). Of the wobbegongs, only Sutorectus tentaculatus and Orectolobus wardi ZBK have poorly developed lobes on the head similar to those of O. hutchinsi . In these species the lobes are simple, and typically reduced in size or rudimentary (rather than mostly lobe-like and well-developed). However, unlike O. hutchinsi , they have a simple nasal barbel (rather than possessing a barbel with an additional, flattened, sub-basal lobe). Adults of Orectolobus hutchinsi also lack rows of warty tubercles along the back which are considered to be diagnostic of S. tentaculatus . Postnatal juveniles of O. hutchinsi have weakly developed rows of dorsal tubercles that become obscure in late juveniles and absent in adults.

Wobbegongs have other unique characters -the morphometrics of the lobe groups on the head appear to be important for distinguishing species. The shapes of lobes in each group, and the distance across the preorbital lobe group in relation to the base widths of both postspiracular groups and their interspaces, are unique to O. hutchinsi . These data should be obtained routinely when treating other members of this family.

  • Peter R. Last, Justin A. Chidlow, Leonard J. V. Compagno (2006): A new wobbegong shark, Orectolobus hutchinsi n. sp. (Orectolobiformes: Orectolobidae) from southwestern Australia. Zootaxa 1239, 35-48: 37-47, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:77AF36F2-0E00-4135-BC39-494A769E7952
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Males mature at about 111 cm TL. Young born at 22-26 cm TL (mean 24.1 cm TL based on 40 specimens). Caught as by-catch of local gillnet, longline, rock lobster and recreational fisheries (Ref. 58024).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Eastern Indian Ocean: an Australian endemic, known only from the inner continental shelf off southwestern Australia from Coral Bay (23°08?S, 113°46?E) to Groper Bluff (34°30?S, 118°54?E) (Last et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Australia: Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Indian Ocean: Western Australia. Sympatric with O. maculatus and O. ornatus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

149 cm TL (male/unsexed; (Ref. 58024))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: A moderate-sized species with the following characters: yellowish-brown when fresh with well-defined, darker brown saddles; absence fo white spots, blotches or reticulations on the fins and body; nasal barbel bilobed; postspiracular lobes are simple, reduced or rudimentary; distance across preorbital lobe group 1.2-1.3 times interspace between preorbital group and postspiracular lobe, 13-15 times base length of anterior postspiracular lobe; base of anterior postspiracular lobe 11-12 in its distance from postorbital group, 4.9-7 in its distance from posterior postspiracular lobe; mouth width 4.7-10.2 times preoral distance; warty tubercles absent on back of adult; juveniles with rows of elevated denticles or poorly defined warty tubercles on back; dorsal fins raked posteriorly; first dorsal fin over rear half of pelvic -fin bases; interdorsal space 0.38-0.56 times anal-fin base length; anal-fin inner margin 0.8-1.1 times anal-fin posterior margin; teeth in upper jaw 25-27, those in the medial row at symphysis rudimentary; spiral valve turns 26-28; monospondylous centra 48-50 (Ref. 58024).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found on the continental shelf at depths of 0.1?106 m (Chidlow et al. 2007). The species reaches at least 149 cm TL (Last et al. 2006). Male specimens were mature at 112 cm TL and female specimens at 110 cm TL. Females probably breed every two or three years and produce 18?29 young per litter after a gestation of 9?11 months, with parturition occurring between July and September (Chidlow 2003). Offspring are born at a size of 22?26 cm TL with an embryonic sex ratio that does not significantly differ from 1:1 (Chidlow 2003). Orectolobus hutchinsi are considered opportunistically-selective feeders that prefer a diet of demersal teleosts and octopi (Chidlow 2003).

Von Bertalanffy growth parameters estimated from vertebral cross-sections and an assumed annual banding pattern were L = 149.45 and K = 0.117 year-1. Although the periodicity of vertebral band formation in captive animals did not support synchronous annual vertebral band deposition, captive growth rates matched those predicted with an annual band-deposition frequency (Chidlow et al. 2007).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 106 m (Ref. 58024), usually 0 - 79 m (Ref. 58024)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 39 - 39
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Orectolobus sp. m

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orectolobus sp. a

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orectolobus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Orectolobus hutchinsi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATATTTAATCTTCGGTGCATGAGCAGGAATAGTAGGTATAGCCCTCAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGGTCACTCCTAGGTGATGATCAGATTTATAATGTGATTGTAACAGCCCATGCTTTTGTAATAATTTTCTTTATGGTTATACCCGTAATAATCGGTGGATTTGGAAATTGATTGGTACCATTAATAATTGGTGCACCCGACATAGCGTTCCCTCGGATAAATAACATAAGCTTTTGACTCCTCCCCCCATCATTTTTATTATTATTAGCTTCTGCCGGAGTAGAAGCCGGTGCGGGAACAGGCTGAACAGTCTATCCACCATTAGCAGGTAATTTAGCCCACGCCGGGGCATCAGTCGATTTAACAATCTTCTCTCTTCACTTAGCAGGAATTTCATCAATTTTAGCATCTATTAATTTTATTACAACTATTATTAACATAAAACCACCAGCTATCTCTCAATATCAAACACCCTTATTTGTTTGATCAATTCTTGTAACCACAATCCTCCTCCTACTGGCATTACCAGTTTTAGCAGCTGGAATTACTATGCTCTTAACCGACCGCAATCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orectolobus hutchinsi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Huveneers, C. & McAuley, R.B.

Reviewer/s
Valenti, S.V. & Pollard, D. (Shark Red List Authority)

Contributor/s

Justification
The Western Wobbegong (Orectolobus hutchinsi) is a relatively recently described, medium-sized (to at least 149 cm TL) wobbegong shark, endemic to Australia. This species is known only from shallow waters on the continental shelf off southwestern Australia, between Coral Bay and Groper Bluff, at depths of 0.1?106 m. The Western Wobbegong is captured as bycatch of a commercial gillnet fishery targeting sharks, a rock lobster (pot) fishery and some small demersal trawl fisheries. Although some information is available about the reproductive biology and age and growth of Western Wobbegong, not enough is known about the impacts of commercial wobbegong catches to assess the species beyond Data Deficient. Further research is required on the possible fishery impacts on this species.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 2003
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Unknown, but more frequently observed in gillnet and trawl bycatches than other smaller orectolobids (i.e., O. floridus and O. parvimaculatus).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Orectolobus hutchinsi is a component of the bycatch of a commercial fishery that targets sharks, primarily with demersal gillnets, off the southern and lower west coasts of Western Australia. Wobbegongs are also caught within the rock lobster (pot) fishery and some small demersal trawl fisheries. Wobbegongs were targeted by a few vessels using demersal longlines in the same fishery until the use of that gear was restricted in 2006. That fishery?s mean annual wobbegong catch was about 45 tonnes year-1 (range 35?68 tonnes) between 1999 and 2006 (McAuley 2007). Although wobbegong catches are generally not reported to individual species, small wobbegongs (<150 cm) are selectively discarded alive (Chidlow et al. 2007, McAuley unpublished data). Thus, O. Hutchinsi is believed to be a small component of those aggregated catches with only large specimens being kept.

Small orectolobids also occur in commercial rock lobster pots throughout temperate coastal Western Australian waters (Chidlow et al. 2007). However, as all sharks and rays are now commercially protected throughout Western Australia, wobbegongs generally cannot be retained by State-managed commercial fishing vessels unless they are operating in the managed shark fishery.

The retained catch of wobbegongs by recreational fishers off the west coast of Australia has been estimated at approximately 1,000 animals year-1 (Sumner and Williamson, 1999). Although the species composition of recreational wobbegong catches is unknown, it is suspected that the majority may be comprised of O. hutchinsi.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
All sharks and rays are commercially protected under Western Australian law. This regulation essentially restricts the retention of all shark and ray products by commercial fishing vessels other than those operating in the State?s managed shark fishery.

Relative to the area known to be occupied by O. hutchinsi, shark fishing effort (mainly demersal gillnet) is sparsely distributed and managed via time-gear input controls. The managed shark fishery?s catches and fishing effort are routinely monitored through analyses of statutory daily/trip logbook data and the fishery?s target stocks are subject to regular stock assessments.

The use of commercial shark fishing gear (large mesh gillnets and demersal longlines) is prohibited north of 26°30? S latitude to 120° E longitude off the north coast, which may include the northern extent of the species? range.

The use of metal snoods (gangions) is commercially prohibited throughout Western Australian waters (except for a small amount of demersal longline effort in the managed shark fishery and pelagic mackerel troll lines).

Recreational fishers are subject to a daily bag limit of two sharks per person.

This species is potentially protected in the following Australian Marine Protected Areas, Marine Parks and nature reserves:

Ningaloo Marine Park, WA
Shark Bay Marine Park, WA
Jurien Bay Marine Park, WA
Hamelin Pool Marine Nature Reserve, WA
Shoalwater Islands Marine Park, WA
Marmion Marine Park , WA
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Orectolobus hutchinsi

Orectolobus hutchinsi, the western wobbegong, is a species of carpet shark in the family Orectolobidae. Despite having been known for many years (often referred to as Orectolobus sp. A), it only received its scientific name in 2006.[2] It is found at rocky reefs off Western Australia between Bremer Bay and Coral Bay at depths down to 106 metres (348 ft).[2] It is a medium-large wobbegong with a skin pattern somewhat resembling that of a jaguar[3] and a maximum length of 1.5 metres (4.9 ft).[2]

See also[edit]

References[edit]

  1. ^ C. Huveneers & R. B. McAuley (2008). "Orectolobus hutchinsi". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 6 February 2010. 
  2. ^ a b c Last, P.R., J. A. Chidlow, and L. J. V. Compagno (2006). A new wobbegong shark, Orectolobus hutchinsi n. sp. (Orectolobiformes: Orectolobidae) from southwestern Australia. Zootaxa (1239):35-48.
  3. ^ Marsh, N. (2007/08). Wobbegong Update... Sportdiving 125: 66-68.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!