Overview

Brief Summary

Biology

These cattle live in small herds of up to 40 individuals, led by a mature bull (2). Usually active during the day, in areas of extensive human contact gaurs have developed more nocturnal habits (2). During the mating season the males' loud bellowing call may be heard over 1.6 kilometres away. Solitary males wander widely in search of potential mates but aggressive encounters are rare, with size tending to determinate dominance (2). Gestation lasts about 275 days with births take place mainly between December and June although they can occur all year round; a female usually gives birth to a single calf (2). Gaurs graze preferentially on green grasses although they will also consume fruit and leaves (2). These cattle have been domesticated and used for both food and work in India (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The gaur is one of the larger of the wild cattle, and individuals can reach over two metres at the shoulder (2). The sleek, dark coat is black in mature males and dark brown in females and juveniles (4). The legs are light coloured and, unusually amongst cattle, there is a ridge of grey between the horns (2). These cattle are extremely heavyset and bulky; they have a large shoulder hump and a dewlap of skin under the chin reaching between the forelegs (4). Both sexes bear horns that are yellow with black tips; the horns leave at the side of the head and curve upwards growing up to 80 centimetres in length (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Miscellaneous Details

"A bull gaur is one of the noblest animals in the world, a model of strength and symmetry, and his formidable appearance has led to his being unjustly credited with a savage disposition. In India all attempts at domestication of this bovine have been failures. The calves appear always to die in captivity, none it is said having been known to attain their third year. But there can be little doubt that the gaur has been tamed and kept tame in some of the hill-tracts between Assam and Burma ; and quite recently a young male animal, now nearly four years old, has been brought to England from Pahaug, in the Malay Peninsula, and is still (1891) living in the Zoological Gardens, Regent's Park.(Blanford 1888)."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

"The Gaur is calso called as the Indian Bison and is the largest species of wild cattle. Although basically diurnal, they have adapted to a nocturnal lifestyle in places with human disturbance. They live in herds of 8-11 individuals, with one bull for each herd. They have few enemies due to their formidable size but calves are known to be taken by leopards and dhole packs."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Gaur historically occurred throughout mainland south and southeast Asia and Sri Lanka. It currently occurs in scattered areas in the following range states: Bhutan, Cambodia, China, India, Lao PDR, Malaysia (Peninsular Malaysia only), Myanmar, Nepal, Thailand, and Viet Nam, but is extinct in Sri Lanka and also, as a resident, apparently in Bangladesh (Grubb 2005; Md Anwarul Islam in litt. 2008; Hedges in prep.). The species is now seriously fragmented within its range, and the mapped distribution is generalised, especially in India, Myanmar, China and Malaysia.

The domesticated form of Gaur, considered by IUCN a separate species (Bos frontalis; Mythun, Mithan or Gayal), occurs in parts of India, China, and Myanmar as feral, semi-feral, and domestic animals. This animal is excluded from the red-listing considerations for Gaur.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Gaurs are found throughout southern Asia. The largest populations are in India (1), but the species also spreads eastwards from India and Nepal to Vietnam and peninsular Malaysia (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Horns pale greenish with black tips, curving outwards, upwards, and slightly backwards, and finally inwards. General colour dark chestnut-brown or coffee-brown; legs from the knee downwards white. The head is square, proportionally shorter than in the Ox. The muzzle is large and full, and the eyes small, with a full pupil of a pale blue colour. The whole of the head in front of the eyes is covered with a coat of close short hair of a light grayish-brown colour, which below the eyes is darker, approaching almost to black. The muzzle is grayish, and the hair is thick and short. The ears are broad and fan-shaped. The neck is sunk between the head and the back, is short, thick, and heavy. Behind the neck, and immediately above the shoulder, rises a fleshy gibbosity or hump, of the same height as the dorsal ridge. This ridge rises gradually as it goes backwards, and terminates suddenly about the middle of the back. The chest is broad, the shoulder deep and muscular, the fore-legs short, with the joints very short and strong, and the arm exceedingly large and muscular. The hair on the neck and breast, and beneath, is longer than on the body, and the skin of the throat is somewhat loose, giving the appearance of a slight dewlap. The fore-legs have a rufous tint behind and laterally, above the white. The hind quarters are lighter and lower than the fore, falling suddenly from the termination of the dorsal ridge. The skin on the neck, shoulders, and thighs is very thick, being about 2 inches and more. The cow differs from the bull in having a slighter and more graceful head, a slender neck, no hump, and the points of the horns do not turn towards each other at the tip, but bend slightly backwards ; and they are much smaller; the legs, too, are of a purer white. The very young bull has the forehead narrower than the cow, and the bony frontal ridge scarcely perceptible. The horns too turn more upwards. In old individuals the hair on the upper parts is often worn off. The skin of the under parts when uncovered is deep ochrey -yellow."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

"This appears to be the largest of existing bovines. Large bulls are said to exceed 6 feet in height at the shoulder, but this is i^are and exceptional, 5 ft. 8 in. to 5 ft. 10 in. being the usual height. Cows are much smaller, about 5 ft. high. Large cows' horns measure 23 and 24 round the outside curve, with a girth of 13.25. The girth of each horn in freshly killed specimens is about an inch more than in dried skulls."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Gaur occurs from sea level up to at least 2,800 m asl (Wood 1937; Wharton 1968; Choudhury 2002). Despite the many reports that call it an animal of hill-country, low-lying areas seem to comprise optimal habitat (Choudhury 2002): in Conry’s (1989) study area, elevations ranged from 46 to 1,079 m asl but the three radio-tracked Gaur only used areas below 381 m. Elevations below 61 m were used most intensively and all three animals selected these low-lying areas; elevations above 61 m were selected against or used in proportion to availability (Conry 1989). Similarly, in the Tenasserim–Dawna mountains, Thailand, signs of Gaur were more abundant in the lowlands than in the hills, noting that this was the opposite of the patterns that would be predicted if hunting (itself concentrated heavily in the lowlands) was the chief determinant of population densities, although solitary animals were found mainly in the hills (Steinmetz et al. 2008). Schaller (1967) compared vegetation maps of India with the (mid-20th century) distribution of Gaur and concluded that the species was largely confined to evergreen, semi-evergreen, and moist deciduous forest but it also occurred in dry deciduous forest areas at the periphery of its range. He considered Gaur habitat to be "characterized by (1) large, relatively undisturbed forest tracts, (2) hilly terrain below an altitude of 5,000 to 6,000 ft (1,500–1,800 m asl), (3) availability of water, and (4) an abundance of forage in the form of coarse grasses (including bamboo), shrubs, and trees". However, He cautioned that the apparent preference of Gaur for hilly terrain may be partly due to the earlier conversion of most of the plains and other low lying areas to croplands and pastures. Similarly, Wharton (1968) concluded that Gaur appeared to avoid evergreen rainforest, "preferring foothill tracts of sub-humid or deciduous forest adjacent to savanna forest, glades or other open terrain affected by man and fire thus co-existing with and exploiting low human populations in hill zones with moderate to heavy rainfall". Throughout the range of Gaur, habitat destruction and human presence is usually higher in lowlands than in hills, meaning that differential human pressures may have caused the apparent preference of Gaur for hills. Gaur occurs in many forest types in Lao PDR, Viet Nam and Cambodia including truly evergreen and montane forest, but populations in closed canopy forests especially those at higher elevations might naturally be at much lower densities than those in lowland areas with a mosaic of open and closed forest types, and in closed canopy forests areas the species appears to frequent grassy openings (Duckworth et al 1999; Greiser Johns 2000; Duckworth and Hedges 1998; Timmins and Ou 2001; R.J. Timmins pers. comm. 2008). No significant difference was found in Gaur densities in moist compared with in dry deciduous forests in Nagarahole, India (Karanth and Sunquist 1992). Steinmetz et al. (in prep.) considered that Gaur herds in an expanding population were consistently concentrated in mixed deciduous forest rather than semi-evergreen forest, although the total area of study, that was safe from poaching, was only 20 km².

Gaur can persist in fragmented areas with some habitat disturbance and hunting, including in landscapes dominated by plantations (such as on parts of the Valparai plateau, south India), but in Southeast Asia it has been too heavily hunted in such areas to survive in them. Gaur can better tolerate rugged terrain and denser forest than other wild and domestic cattle, provided that there are adequate water sources (N.S. Kumar pers. comm. 2008.; Smith and Xie Yan in press). In Thailand it uses former cultivation amid forest, and populations in such areas can recover well if not hunted (Anak Pattanavipool pers. comm. 2006; R. Steinmetz pers. comm. 2006). A study of coffee estates around Bhadra Wildlife Sanctuary, India, recorded Gaur only in those coffee areas within 1 km of the sanctuary’s boundary (Bali et al. 2007).

Gaur both grazes and browses, reportedly eating mostly young green grasses but also leaves, fruit, twigs, and bark of various woody species, as well as coarse dry grasses, and bamboo. It seems able to maintain good condition on relatively low quality feed. At least 180–190 species of plants have been recorded in the diet (N.S. Kumar pers. comm. 2008). More information is given about Gaur’s diet in Dunbar Brander (1923), Hubback (1937), Schaller (1967), Wharton (1968), Krishnan (1972), Khan (1973), Conry (1981), Ebil Yusof (1982), Ramachandran et al. (1986), Prayurasiddhi and Smith (1993) and Sankar et al. (2000). Captive Gaur are reported to eat about 20 kg of green fodder per day (Ramachandran et al. 1986). During the cool season (November–February) the Gaur that Schaller (1967) studied in central India ate various herbs, large quantities of the leaves and seeds of bamboo, various other grasses, and the leaves of a number of tree species; but by the beginning of the hot season (March–June) coarse dry and semi-dry grasses made up the bulk of their diet, averaging 85% by volume (range 66–100%; four rumen samples), with browse only making up about 10%. Gaur also feeds on crops including corn, cassava, and young rubber trees, sometimes causing great damage (Wharton 1968; National Research Council 1983). Schaller (1967) reported that Gaur in Kanha National Park drank at least once per day during the hot season, usually in the evening. Sahai (1972) stated that Gaur drink at least twice in a 24-hour period but there appears to be no fixed time for drinking.

In undisturbed areas, Gaur is mainly diurnal, but in areas of high human disturbance, it is reported to become mainly nocturnal.

The basic social group appears to be a female–juvenile unit with larger groups tending to be more-or-less temporary assemblages (as in the other large species of Asian Bovini). Maternal herds containing several adult cows, juveniles, and calves frequently occur but their composition is somewhat fluid, particularly during the rut; these herds can often contain several subadult and adult males. The number of bulls in a herd changes with the time of year. Mature males associate with cows primarily during the rut: during Schaller’s study in Kanha National Park 65% of herds were accompanied by a mature male during April (the peak of the rut) but during the second half of the year the proportion dropped to 31% (Schaller 1967). Neither Schaller (1967) nor Sahai (1972) found any evidence to support Powell’s (1964) statement that young bulls usually live apart from the maternal herds; nor did Schaller’s observations support Dunbar Brander’s (1923) statement that the ‘master bull’ drives all other males from the herd. Males not associating with mixed herds either live in all-male groups or are solitary. The bull herds are generally unstable, although sometimes two or more animals may frequently associate. The typical herd size appears to be in the range of 5–12 animals and herds are rarely larger than 20 (Dunbar Brander 1923; Hubback 1937; Hislop 1961a; Schaller 1967; Prater 1971; Sahai 1972; Pal and Guin 1986). Large groups of 20, 40, or even 100 animals are probably temporary aggregations of smaller groups (Pal and Guin 1986).

The majority of the 125–150 Gaur studied by Schaller (1967) in Kanha National Park (India) ranged over an area of at least 78 km²; and the herds he studied travelled on average 2–3 miles (3.2–4.8 km) a day, although on occasion the distance could be much less. In West Malaysia Gaur home ranges have been estimated to be: approximately 13 km² (the Kuala Tahan herd in Taman Negara National Park) (Weigum 1972); and 29.9 km² for a yearling male, 52.1 km² for a yearling female, and 137.3 km² for an adult male in Pahang (Conry 1989). The large differences between the two studies probably reflect the different methods employed by the two workers (see Conry 1989: 60). Home ranges that can be as large as 137 km² hinder the setting aside of conservation areas for Gaur, particularly as Gaur often occurs in those areas where the pressures for economic development are highest.

In central India, most Gaur mate in December and January, and calves are born in August and September according to Dunbar Brander (1923); Stebbing (1911) and Sanderson (1912) generally agreed with Dunbar Brander but noted that calves may also be born in April, May, and June. In Kanha National Park (central India) Schaller (1967) recorded rutting bulls from December to June, with an apparent peak of sexual behaviour in March and April; however, the occurrence of a few new-born animals throughout the year indicated that some mating must occur in every month. In southern India the majority of matings reportedly take place between November and March (Morris 1937). In Cambodia the majority of Gaur births occur in December and January (Wharton 1957). In Myanmar, calves are born throughout the year (Evans 1912; Peacock 1933); and in West Malaysia young Gaur are seen in all months except October to December (Hubback 1937).

The gestation period of Gaur is reported to be nine months by Hubback (1937) and Crandall (1964) and 270 days, ‘a little shorter than for Banteng or domestic cattle and longer than for yak and Kouprey’, by National Research Council (1983: 49). Only one calf is born to a cow per pregnancy; there are no records of twins (Hubback 1937; Schaller 1967). Females probably first mate when about two years old and thus have their first calf at three years old (Schaller 1967). If the food supply is favourable, most adult females probably calve every year. In Kanha National Park, approximately 90% of adult cows bore young during a year but calf mortality was high, with about 50% of the calves dying before reaching one year old; the main cause of death was predation by Tigers Panthera tigris (Schaller 1967).

Rarely, bulls kill each other when fighting, and occasionally they are severely injured while fighting. Predation is by far the major cause of Gaur mortality, perhaps followed by disease (N.S. Kumar pers. comm. 2008). For example in Bandipur, Gaur is the most important prey in terms of the biomass taken by Tiger (42%) and Leopard Panthera pardus (15%) (Andheria et al. 2007). In Bandipur, Gaur remains were found in about 24% of Tiger faeces and 9% of Leopard faeces (Andheria et al. 2007). In adjoining Nagarahole, the proportion of Gaur in Tiger’s diet was about 45% in kills, 17% in scats (Karanth and Sunquist 1995). In Tadoba-Andhari, Gaur together with Sambar contributed to nearly 70% of the prey biomass consumed by Tiger, whereas in Pench-Maharashtra it was 80% (Karanth and Kumar 2005). In well protected forest reserves where different body-sized ungulates are abundantly available, Gaur is selectively predated by Tiger (N.S. Kumar pers. comm. 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Restricted to forested hilly areas in evergreen, deciduous and savannah forest often associated with glades and relatively open terrain (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"The gaur keeps to forest or high grass, generally but not always near hills, and is found in herds of from five or six to about 20, or occasionally more. Bulls often wander by themselves, and the finest and oldest bulls are said always to occur solitary ; still very large bulls are found with herds, and young bulls are frequently seen alone, or two or three together. All are shy and avoid cultivated tracts as a rule, though instances occur in wild parts of the country of gaur feeding on growing crops. Their food consists chiefly of grasses ; they do not commonly browse, though they occasionally eat the leaves and even the bark of particular trees, and they are fond of the shoots of bamboos. They feed generally in the early morning and evening, and lie down to rest from about 9 A.M. to about 4 p.m., and at night. They drink as a rule in the afternoon. These bovines inhabit the hills of the Indian Peninsula to an elevation of 5000 or 6000 feet, or occasionally even higher ; but they do not ascend the Himalayas to nearly the same extent. They are admirable climbers, and ascend or descend steep hills with wonderful facility. They are timid animals, but in wild places, where they are rarely subject to attack and disturbance, they are by no means remarkably wary. Wounded animals occasionally charge, and solitary bulls have been known to attack without provocation. According to Sanderson, three distinct sounds are uttered by this species. The first is a sonorous bellow, used as a call, and unlike any of the usual bovine sounds. The second is a low """"moo,"""" indicative of apprehension or curiosity. The third is the well-known whistling snort."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

"The period of gestation is not known with any certainty. Breeding is said to lake place in the cold season. The calves are mostly born (in the Peninsula of India) in August or September, a few early in April, May, or June."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bos gaurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bos gaurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGACTATTCTCAACTAACCACAAAGATATCGGTACTCTTTATCTGCTATTTGGTGCCTGAGCCGGAATAGTAGGAACAGCTCTAAGCCTCTTAATTCGCGCTGAATTGGGCCAACCCGGAACCCTGCTCGGAGACGACCAAATCTATAACGTAGTTGTAACCGCACACGCATTTGTAATAATCTTCTTCATAGTAATGCCAATCATAATTGGAGGATTTGGTAACTGACTTGTCCCTCTAATAATTGGCGCTCCCGATATGGCATTCCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCATTTCTATTACTCCTCGCATCTTCTATAGTTGAAGCTGGGGCAGGAACAGGCTGAACCGTGTACCCTCCCTTAGCAGGCAACCTAGCCCATGCAGGAGCCTCAGTAGACCTTACCATCTTCTCCTTACACTTAGCAGGAGTTTCCTCAATTTTAGGAGCCATCAACTTCATTACAACAATCATCAACATAAAGCCCCCCGCAATGTCACAATATCAAACCCCTCTGTTCGTATGATCCGTAATAATCACCGCCGTGCTATTACTCCTCTCACTCCCTGTGTTAGCAGCCGGCATCACAATGCTGCTAACAGACCGTAACCTAAATACAACCTTCTTCGACCCGGCAGGAGGAGGAGACCCCATTCTATACCAACACTTATTCTGATTCTTTGGACACCCCGAAGTCTATATTTTAATTTTACCCGGGTTTGGAATAATTTCCCACATTGTAACCTATTACTCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTTTGGGCTATAATGTCAATTGGATTTTTAGGCTTCATCGTATGAGCTCACCATATATTCACAGTCGGAATAGATGTCGACACACGAGCCTACTTCACATCAGCCACTATAATTATTGCCATTCCAACCGGAGTAAAAGTTTTCAGCTGACTGGCAACACTTCATGGAGGAAATATCAAATGATCTCCTGCTATAATATGAGCCCTGGGTTTTATCTTCTTATTTACAGTAGGAGGCCTAACCGGAATTGTATTGGCCAACTCTTCTCTCGATATCGTTCTCCACGACACATATTACGTTGTCGCACATTTCCACTATGTTTTATCAATAGGAGCTGTATTTGCTATTATAGGGGGATTTGTTCACTGATTCCCACTATTCTCAGGCTATACCCTCAATGATACATGAGCTAAAATCCACTTCGCAATTATATTCGTAGGCGTCAATATGACCTTCTTTCCACAACACTTTCTAGGACTATCTGGCATGCCTCGACGATACTCCGACTACCCAGATGCATACACAATATGAAATACTGTCTCATCAATGGGCTCATTTATTTCTCTAACAGCAGTTATACTAATAGTTTTCATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTCTTGACTGTAGACCTAACCACAACAAATCTAGAATGATTAAACGGATGTCCCCCACCATACCACACATTTGAAGAACCCACCTATGTTAATCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd+3cd+4cd

Version
3.1

Year Assessed
2008

Assessor/s
Duckworth, J.W., Steinmetz, R., Timmins, R.J., Pattanavibool, A., Than Zaw, Do Tuoc & Hedges, S.

Reviewer/s
Burton, J. & Hedges, S. (Asian Wild Cattle Red List Authority)

Contributor/s

Justification
This species qualifies as Vulnerable under Criteria A2cd+3cd+4cd. The population decline in parts of the species' range especially Indochina and Malaysia, perhaps also Myanmar and China, is likely to be well over 70% over the last three generations (generation length estimated at 8–10 years), whereas in India and Nepal the overall decline rate is considerably lower. This reflects that in the various reasonably well-protected areas, population trends are stable, and in a few areas which have been neglected but are the focus of improved protection, populations are rebuilding. Weighting these by population size gives an overall decline of at least 30% over the last three generations. Similar reductions are projected, largely because the causative factors (especially wild meat hunting and hunting for the trade in horns in Southeast Asia) are still operative. Although the proportion of the global population which is in relatively well protected in India is increasing, and thus the averaged global decline rate ought to decrease, an ongoing decline of 30% (in the next three generations) or more is adjudged likely. The recent history in Malaysia proves that directed Gaur poaching can induce rapid declines in regions previously judged relatively safe. Poaching in Malaysia is undertaken by international gangs and it is likely that once returns in Malaysia drop they will move to other countries; the patterns in other high-value species in more advanced declines (e.g. southeast Asian otters) indicate that incursion even to southern India is likely. The species could potentially qualify for Vulnerable under Criteria C, although there are not enough quantitative data available

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red List Category & Criteria: Vulnerable A2cd+3cd+4cd ver 3.1 Year Published: 2008
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to lie within 13,000–30,000 animals. Field data suggest that the proportion of mature individuals in the population is likely to be 0.4–0.6, indicating a total of 5,200–18,000 mature individuals, with no population known to have over 1,000 individuals (S. Hedges pers. comm. 2000). Most population figures given for numbers of Gaur are little more than guesses.

In Bangladesh, Gaur is probably extinct (Md Anwarul Islam in litt. 2008). A few were thought still to occur in the Chittagong, Chittagong Hill Tracts, Sylhet, and Mymensingh areas in the early 1980s (Sarker and Sarker 1984), but none had been seen in Pablakhali Wildlife Sanctuary in the Hill Tracts since the early 1970s (Khan 1985). Choudhury (2002) stated that Gaur individuals from Mizoram and Tripura (India) still cross into Bangladesh, although the records on which this was based were not given.

In Bhutan, Gaur apparently persists all over the southern foot-hill zone, notably in Royal Manas National Park, Phipsoo Wildlife Sanctuary and Khaling Wildlife Sanctuary (Choudhury 2002).

In Cambodia, Gaur probably declined by 90% or more in the period from the late 1960s to the early 1990s, at which time it still remained widespread, outside the lower Mekong and Tonle Sap lowlands, although in generally low numbers (Heng Kimchhay et al. 1998; Daltry and Momberg 2000; Timmins and Ou 2001; R. J. Timmins pers. comm. 2008). By far the most substantial Gaur population of the country remained in eastern Cambodia centred on Mondulkiri province, where in the late 1990s potentially several hundred to a thousand may have survived in a forested landscape of over 15,000 km² (Timmins and Ou 2001; Tordoff et al. 2005; R.J. Timmins pers. comm. 2008). Further declines, of about 50%, took place from the early 1990s to the present (R.J. Timmins pers. comm. 2008). As of 2007 the most significant population by far in Cambodia still remained within Mondulkiri Province (R. J. Timmins pers. comm. 2008 based on WCS and WWF unpublished data; T. Clements pers. comm. 2007; T.D. Evans pers. comm. 2007). Protection efforts in part of this landscape have probably stabilised the population there (R. J. Timmins pers. comm. 2008 based on WCS and WWF unpublished data; T. Clements pers. comm. 2007; T.D. Evans pers. comm. 2007). Protection outside these two areas is limited and for Cambodia as a whole the trend is still a significant decrease (R. J. Timmins pers. comm. 2008).

In China, Gaur occurs in Yunnan and southeast Tibet (Ma Yiqing and Wang Yingxiang 1995). All sites in Yunnan (except Yingjiang) formed, until the 1950s–1960s, one large contiguous population, but this is now heavily fragmented. By the 1980s, the species was extinct in Lancang county, and the remaining animals were split into two populations: Xishuangbanna–Simao and Cangyuan (Wang Yingxiang verbally 1998 to Duckworth and Hedges 1998). Some sources suggest that a population of 600–800 existed in Yunnan Province in the mid-1990s, with the majority occurring in Xishuangbanna National Nature Reserve (Ma Yiqing and Wang Yingxiang 1995); other sources suggest that only small numbers of Gaur remain in Yunnan (along the border with Myanmar) and that hunting had led to the local extinction of Gaur in Xishuangbanna (Xiang and Santiapillai 1993).

In India, three major (Western Ghats, Central India and North-East) and two minor (Bihar and West Bengal) “Gaur conservation areas” have been identified, reflecting the remaining distribution (Sankar et al. 2000; Choudhury 2002). The Western Ghats and their outflanking hills in south India constitute one of the most extensive extant strongholds of Gaur, with good numbers in Wynaad – Nagarahole – Mudumalai – Bandipur complex (Ranjitsinh 1997). Recent distributional assessment surveys in the Karnataka part of the Western Ghats showed the presence of Gaur in more than 60% of the 22,000 km² landscape (K.U. Karanth and N.S. Kumar unpublished data). Ranjitsinh (1997) estimated 12,000–22,000 in India, while Choudhury (2002) suggested that there were about 23,000–34,000 Gaur in India, Bhutan, and Bangladesh; but the true number is simply not known, as shown by the wide ranges. Major populations have been reported in Nagarahole National Park (probably over 2,000), Manas Wildlife Sanctuary (not known; may not be large), Bhadra Wildlife Sanctuary (over 800), Melghat Tiger Reserve (perhaps 500), Bandipur National Park (over 2,000), Kanha National Park (probably under 200), Radhanagari Wildlife Sanctuary (not known; may not be large), Tadoba–Andhari Tiger Reserve (over 1,000), Periyar Tiger Reserve and adjoining forest complex (500–1000), Annamalai range complex (Parambikulum, Valparai, and Grass Hills) (500–700), Silent Valley and adjoining forest complex (500–1000), Agastyamalai forest complex (about 500), Biligirirangangswamy Wildlife Sanctuary and Malemahadeswara Hill range (over 1000), Anshi–Dandeli Tiger Reserve and adjoining forest mosaic (perhaps about 400), Kudremukh National Park and Someshwara Wildlife Sanctuary (about 200–400), Brahmagiri–Pushpagiri–Talakaveri Sanctuary, Mukurti National Park, Pench Tiger Reserve, Jaldapara Wildlife Sanctuary (‘a large population’), Chapramari Wildlife Sanctuary (‘a large population’), and Gorumara Wildlife Sanctuary (‘a large population’). Many other areas are known or suspected to hold small populations, but in many sites such small numbers are unlikely to be viable (Choudhury 2002). The foregoing figures were assigned by N.S. Kumar (pers. comm. 2008) and are based on a variety of sources and methods, and from most areas are for guidance only. An increasing rigour is being applied to large mammal population estimation in India and some of the figures here will warrant modification and future changes to the quoted populations should not necessarily be seen as indicating that a real change in numbers has occurred. In recent years Gaur has reportedly been exterminated from three protected areas, Thattekad Wildlife Sanctuary (Kerala), Bhandhavgarh (Madhya Pradesh) and Kanger Valley National Park (Madhya Pradesh) (Pasha et al. 2004). Information on population status from the states of Andhra Pradesh, Orissa and North-East is limited (Choudhury 2002); there are demonstrably very few Gaur in Kaziranga (Karanth and Nicholls 2000). Recent population trends appear to have been stable in well protected areas. The following densities have been estimated: Bhadra Tiger Reserve, 1.48 +/- 0.63 (SE) per km² (Jathanna et al. 2003); Pench (Madhya Pradesh) dry deciduous forest, 0.7 animals per km² (Karanth and Nichols 2000); Nagarahole moist deciduous forest, 9.6 animals per km², making it the second-most abundant ungulate there (Karanth and Sunquist 1992); Bandipur dry deciduous forest, 7.0 animals per km² (Karanth and Nichols 2000); Tadoba-Andhari dry deciduous forest, 1.8 animals per km² (Karanth and Kumar 2005); Melghat dry deciduous forest, 1.0 animals per km² (Karanth and Kumar 2005); Pench (Maharashtra) dry deciduous forest, 0.8 animals per km² (Karanth and Kumar 2005). No densities could be estimated, despite the use of suitable survey methodology, at Kanha or Namdapha, implying relatively low populations, and none was found during such surveys at Kaziranga or Ranthambore (Karanth and Nichols 2000); only small numbers persist in Kaziranga (N.S. Kumar pers. comm. 2008). The Bhadra density is low, reflecting poaching (using snares, dogs and shotguns) and livestock grazing. However, the Gaur population there is now steadily increasing with successful conservation interventions (K.U. Karanth and N.S. Kumar unpublished data). A study at Nagarahole National Park compared the fauna of an area which was only moderately hunted with a heavily hunted site: this found respective densities of six and two Gaurs per km² (Madhusudan and Karanth 2002).

In Lao PDR, Byers et al. (1995) stated that the national population was approximately 1,000. This number is perhaps possible (field records exist from many areas), but animals would have been widely dispersed and at very low density in the extensive forest tracts across the country, with perhaps fewer than six sites holding more than 50 animals (Duckworth and Hedges 1998; Duckworth et al. 1999; Steinmetz 2004; R.J. Timmins pers. comm. 2008). A large population of Gaur was found in Nakai–Nam Theun NPA and the adjoining Nakai Plateau in the mid 1990s, when signs were readily found and even the animals themselves seen directly (Duckworth 1998; Duckworth and Hedges 1998; Evans et al. 2000). Resurveys of both areas, although using comparable methodology only on the plateau, indicate massive declines in the subsequent decade, with, for example, fairly intensive camera-trapping not recording the species at all (Dersu 2007; Johnson and Johnston 2007). The last decade has seen major reductions (in general, probably of well over 50%), in many large mammal populations across Lao PDR and it is now likely that many of the populations listed in Duckworth and Hedges (1998) have become locally extinct (Timmins and Robichaud 2005; R.J. Timmins pers. comm. 2008).

In Malaysia, in 1994 the population was stated to be less than 500 individuals and it was thought to be declining (J. Brennan pers. comm. to Read et al. 1994; a number of other stated numbers from around that time, all of the same general order of a few hundred, and none derived allowing a quantification of error margin, are presented in Hedges in prep.), with then confirmed records from various sites, e.g. the Sungai Singgor area of Temenggor Forest Reserve, Hulu Perak (Ratnam et al. 1995). In the subsequent few years, the population collapsed, despite optimism through relatively stronger control of guns in Malaysia than elsewhere on the southeast Asian mainland, and a perception (e.g. Nash 1993) of relatively strict control of wildlife trade in Malaysia. Densities in Taman Negara were crudely estimated from surveys during 1999–2001 as 0, 3 and 22 Gaurs per 100 km² in three study sites (Kawanishi and Sunquist 2004). Although these authors adjudged large mammal poaching to be negligible in Taman Negara, high levels were confirmed there by Wan Shahruddin (1998) and camera-trapping (suitable in methodology and intensity to find Gaur if any significant numbers were present) did not record Gaur at a fourth sector of Taman Negara in 1999 (Lynam et al. 2007). No Gaur was photographed at all in eight other potential Tiger areas surveyed by Lynam et al. (2007) during 1997–1999, including Temenggor (see Ratnam et al. 1995); because these were selected as the areas most likely to support Tigers and as Tiger-oriented camera-trapping elsewhere in South-east Asia usually yields photographs of Gaur, this study proves that only very low numbers of Gaur remain in Malaysia, no doubt way below the estimate in Read et al. (1994). Further supporting this, none was found in the Jerangau Forest Reserve, from which it was suspected to have been eradicated by hunting (Azlan 2006). Gaur was found in only two of 14 sites (seven virgin jungle reserves and seven adjacent logged areas), making it among the most localised mammal species which was detected in a study assessing the importance of virgin jungle reserves. The two occupied sites were a contiguous pair in each management class, and among the biggest sites surveyed (over 100 km²); the virgin jungle reserves themselves rarely exceed 3 km² (Laidlaw 2000). In the 1960s, there were estimated to be approximately 40 Gaur in Krau Wildlife Reserve, a figure deemed optimistic at the time; in the 1980s there were thought to be 22–31; in 1995 the estimate was only seven. When surveying the reserve in 2000 (see DWNP/DANCED 2002), R. Dunlop (pers. comm. 2008) covered the whole reserve (about 440 km²) with camera-traps in 119 one km-grid squares. Out of a total of 6,918 periods of 24-hour trapping, 61 species were recorded in 1,804 photographs of wildlife, yet only one photograph was of a Gaur. In almost 100 days of field searching for signs, Gaur tracks were recorded only on eight days, on each occasion as prints of isolated animals. The photograph, the sole sighting, and the eight track records were all in the south-east lowland area of the reserve, moving between an area of salt-licks and grazing just outside the reserve. This survey corroborated the 1995 estimate of seven animals, and the 2000–2001 figure could be even lower. Sumatran Rhinoceros Dicerorhinus sumatrensis and Asian Elephant Elephas maximus have both disappeared from Krau, and Gaur may be the next species to go. R. Dunlop (pers. comm. 2008) considers there no reason to expect this recent history not to typify that of Gaur populations at all sites in Malaysia. There are very recent records from: Tanjong Mentong in Taman Negara, where tracks were found during elephant surveys in late 2006 (Nurul Huda, WCS Malaysia pers. comm. 2008); Belum, in 2007, where animals were camera-trapped at salt-licks several times, including a herd of seven (Ahmad Zafir, WWF Malaysia pers. comm. 2008); and Temenggor, where individual animals (no herds) were camera-trapped nine times (never at salt licks, always on logging roads) in 2,364 trap-nights in 25 locations (Mark Darmaraj, WWF Malaysia pers. comm. 2008).

In Myanmar, the status of Gaur is poorly known (J.W. Duckworth and Than Zaw pers. comm. 2006). A March 1994 survey of Taminthi Wildlife Sanctuary, Myanmar's largest protected area, guessed that 100–200 Gaur remained, and that they were in danger of being extirpated from the area if current levels of poaching continued (Rabinowitz et al. 1995). A national Tiger survey camera-trapped Gaur in 11 of 15 camera-trapped sites, commonly in several (Lynam 2003); these sites were selected for their chances of holding Tigers, so, because the two species face similar threats, it may present the most positive picture of Gaur occurrence in the country.

In Nepal, the Gaur population was estimated to be 250–350 in the mid-1990s, with the majority in Chitwan National Park and Parsa Wildlife Reserve; population trends appeared to be relatively stable (J. Heinen pers. comm. to S. Hedges 1995). A few other areas hold small numbers (Choudhury 2002).

In Thailand, an estimated total of 920 Gaur remained in 1994. Only 6–7 populations were thought to contain 50 or more animals and there were no Gaur outside protected areas. The most important protected areas for Gaur were Khao Yai National Park, Tap Lan National Park and Pang Sida National Park, Huai Kha Khaeng Wildlife Sanctuary, Thung Yai Naresuan Wildlife Sanctuary, Kaeng Krachan National Park and Mae Nam Phachi Wildlife Sanctuary, the Khlong Nakha complex, and possibly Om Koi and Mae Tuen Wildlife Sanctuaries. Even in protected areas with much suitable habitat Gaur densities were very low, for example in Huai Kha Khaeng Wildlife Sanctuary the population density was less than 50% of the estimated carrying capacity of the area (Srikosamatara and Suteethorn 1995; S. Hedges pers. comm. 2000). Gaur populations are probably now increasing in several sites in Thailand, notably in Huai Kha Khaeng Wildlife Sanctuary and Thung Yai Naresuan Wildlife Sanctuary, with effective tackling of poaching. In Thung Yai Naresuan Wildlife Sanctuary, sign monitoring in one small area (20 km²) over six years since poaching absolutely ceased indicated an annual population growth rate there of 0.31, although the relative contributions of birth and immigration could not be distinguished. Breeding herds became much more common, compared with the situation 10–15 years previously at the height of poaching (Steinmetz et al. in prep.). In the Khao Paeng Ma reforestation site adjacent to Khao Yai National Park the population apparently expanded from two to 100 Gaur in less than 10 years, initially reflecting recolonization but apparently mostly from reproduction among animals at the site, all within a 10 km² area of secondary forest. The population stabilized at about 100 animals during 2004–2007 (based on counts from hilltops). As the forest grows and browse and grass diminish, reproduction is likely to decline (R. Steinmetz pers. comm. 2008). This herd has flourished only by dint of the provision of 24-hour security (A.J. Lynam pers. comm. 2008). Numbers also seem to be expanding rapidly in Kuiburi National Park in southern Thailand, again from an artificially lowered population and again within a secondary forest area adjacent to semi-evergreen forest. In early 2008, a (temporary) herd of almost 50 animals was spotted by elephant-watchers in a tree hide; only a few years previously, there were probably far fewer than this in the whole area (Steinmetz et al. 2007; R. Steinmetz pers. comm. 2008). By contrast, Gaur is largely gone from southern Thailand forest remnants, although it may be safe on the Malaysian border, reflecting tight control of illegal access and activities by the Border Patrol Police, and the danger of operations because of insurgency (A.J. Lynam pers. comm. 2008).

In Viet Nam, the current status of Gaur is poorly known. Several areas in Dak Lak Province (the Easo and Easup areas and Yok Don National Park) were known to contain Gaur in 1997 (Le Xuan Canh et al. 1997) but very little reliable information was traced for other parts of the country by Duckworth and Hedges (1998). Several herds of Gaur persist in Cat Tien National Park and in adjacent state forest enterprises (Polet and Ling 2004). There seems little room for doubt that the Gaur population is in serious decline, and many of the sites reported in Duckworth and Hedges (1998) may now have lost the species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The set of threats and the gravity of each threat to Gaur differs greatly between south and central India, and Southeast Asia; China and most of northeast India are more similar to Southeast Asia in this respect (Farshid Ahrestani pers. comm. 2008), and are so treated in the following discussion.

In Indochina, Myanmar, and northeast India, hunting is the major problem, compounded by loss of suitable habitat: large tracts of suitable habitat hold few or no Guar. Ongoing habitat degradation and conversion is continually reducing the potential population, should hunting be brought under control (Duckworth et al. 1999; Duckworth and Hedges 1998; Timmins and Ou 2001; Choudhury 2002; Steinmetz 2004; Than Zaw pers. comm. 2006; R.J Timmins pers. comm. 2008; Farshid Ahrestani pers. comm. 2008). Hunting is often for meat and a variety of methods is used (Choudhury 2002). There is also a flourishing international trade in Gaur parts, both horns (decorative) and internal organs (for medicinal purposes). Given the small size of the remaining Southeast Asian subpopulations and the number of trophies found for sale in Cambodia, Lao PDR, Thailand, and Myanmar during essentially opportunistic surveys, trade is clearly a major threat (Srikosamatara et al. 1992; Baird 1993; Srikosamatara and Suteethorn 1994, 1995; Martin and Phipps 1996; Srifa La-Ong et al. 1997; Duckworth et al. 1999). The most important population in Cambodia is scattered through a forest landscape that encompasses four provinces (Mondulkiri, Kratie, Stung Treng and Ratanakiri) and five conservation areas (Lomphat Wildlife Sanctuary, Phnom Prich Wildlife Sanctuary, Siema Biodiversity Conservation Area, Mondulkiri Protection Forest (including the Srepok Wilderness area) and Phnom Nam Lyr Wildlife Sanctuary). Hunting is still rife in much of this area, and forest fragmentation is rapidly accelerating with human population immigration, infrastructural developments (especially roads), commercial agricultural expansion, economic land speculation and mineral extraction. However, although perhaps less than 20% of this area is well protected from the aforementioned threats and protected area management is only close to effective in two areas, the most significant constraint to the area’s Gaur is the long-term uncertainty of continuation of effective conservation management of the Srepok Wilderness Area and Siema Biodiversity Conservation Area. Although conservation efforts for Gaur and many other species are, in both these areas, extremely encouraging, both face an uncertain future with the possibility of degazettement of conservation status of parts of them, the possible loss of adequate external funding necessary to maintain high standards of management, the possible loss of political support necessary to uphold high protection standards and the uncertainties of maintaining a motivated well trained staff. Almost throughout Southeast Asia, protected areas are not yet stalling declines in mammals with commercial value, such as Gaur. Areas with stabilized populations (in addition to the two Cambodian areas, perhaps only a few areas in Thailand (see Population) and Cat Tien National Park in Viet Nam) are exceptional (R. Steimetz pers. comm. 2008; R.J. Timmins pers. comm. 2008).

Surprisingly, given its retention of healthy populations of other high-value very large mammals (Tiger and Asian Elephant Elephas maximus; Lynam et al. 2007; S. Hedges pers. comm. 2008 for elephants), Malaysia has among the most rapidly declining populations of Gaur. This reflects targeted hunting for large mammals of high commercial value, even within protected areas (Abdul Kadir 1998; Wan Shahruddin 1998; Lynam 1999; DWNP/Danced 2002; Lynam et al. 2007). Given the rapid decline within the 1990s and the lack of information traced since 2002, the exact current situation of Gaur in Malaysia is unclear. Kemasul Forest Reserve, where the species was found in Laidlaw’s (2000) survey of virgin jungle reserves, probably no longer exists as such. Even at the time of survey, most of the Forest Reserve was due to be converted into an Acacia mangium plantation, although still nominally a Forest Reserve. Kemasul was, long ago, part of a massive block of lowland forest which included the famous Jengka Triangle and Krau "Game" Reserve. Only Krau remains, albeit much reduced (R. Dunlop pers. comm. 2008). Even Krau, which was set up (in 1923) principally for the protection of Gaur, numerous in the area then, faces multiple threats (R. Dunlop pers. comm. 2008). In the surveys for DWNP/DANCED (2002), evidence of hunting, including cartridges, was found within the reserve, particularly in the easily accessible lowland areas; there were plenty of hunting stories by and about all of the different local communities, without exception, although their preferred target species differed. Conversion from natural forest to other land-uses of adjacent state-land combined with new ease of access has undoubtedly made Krau more of a focal point for such activity. There is a new (metalled) road and land conversion right up to the boundaries, facilitating access and easing the use of hunting methods such as spotlighting, as well as reducing habitat. The salt licks (for which Krau used to be famous) increasingly fall outside the forest (reflecting shrinking reserve boundaries and farmland encroachment into the reserve) and are now mostly in zones of high human activity of one sort or another. Temporary grasslands generated through traditional indigenous farming, which were often fairly difficult to get to and thus relatively free from hunting, were previously important Gaur habitat. A forester who used to work in Malaysia in the 1940s said that Gaur herds used to follow the Orang Asli settlements, moving in when they moved out, and Weigum (1972) even recommended "...to maintain herds in the park it is recommended that 45 acres of land be clear-cut preferably in 15 acre plots ½ mile apart and be recut every three years". Gaur meat is, or at least was being, sold at restaurants in placed like Cameron and Grik.

In south and central India, densities are likely to be widely below ecological carrying capacity, through hunting and competition with domestic livestock, although this conclusion is based on rather few empirical studies and there are some outstanding populations in well-secured protected areas. Substantial declines and local extinctions of Gaur were driven by hunting (for meat), competition with livestock, and habitat conversion, particularly during the first half of the twentieth century, resulting in a drastically reduced and fragmented distributional range, especially outside the protected area network (N.S. Kumar pers. comm. 2008). Hunting is much less prevalent than in Southeast Asia, reflecting the general enforcement of wildlife protection laws (Farshid Ahrestani pers. comm. 2008). Nonetheless, even in high-profile reserves, it is still suppressing densities significantly. For example, densities in Bhadra Tiger Reserve are very low, because of poaching, by comparison with what the habitat should support (Jathanna et al. 2003), and the measured density in a heavily hunted area of Nagarahole National Park was only a third of that in a well secured area (Madhusudan and Karanth 2002). Even though all hunting is illegal in this protected area, preventive measures are uneven across it, and Gaur is still poached, at least sporadically, wherever protection effectiveness is low (N.S. Kumar pers. comm. 2008). In recent years Gaur, has reportedly been exterminated from three Indian protected areas, Thattekad Wildlife Sanctuary (Kerala), Bhandhavgarh (Madhya Pradesh) and Kanger Valley National Park (Madhya Pradesh) (Pasha et al. 2004). Interaction with domestic stock is greatly under-appreciated as a threat to Gaur, but is probably the main factor which currently limits populations in south and central India: livestock are widely grazed even in otherwise well-managed protected areas. Mean densities of Gaur were fully 132 times higher in livestock-free areas than in adjacent livestock-grazed areas of Bandipur, and in shared grazing areas Gaur densities declined sharply with increasing livestock densities; in the grazed area studied, halving the livestock density allowed increases of Gaur by a factor of 57 (Madhusudan 2004). Threats to southern India’s forest ungulates by competition with domestic stock grazing within protected areas are exacerbated where dung is collected for export to adjacent coffee areas. Fuel wood removal may also be at levels sufficient to disrupt nutrient cycles of the habitat (Madhusudan 2005). Many Indian forest areas are severely encroached by exotics such as Lantana camara, Parthenium spp. and Chromolaena odorata, and these are suspected to effect major changes to forest structure (Hiremath and Sundaram 2005): but the effects of these on Gaur populations warrant further study. Killing of Gaur in retaliation to crop damage (through consumption and trampling) occurs, but is of limited significance to conservation (Choudhury 2002; Farshid Ahrestani pers. comm. 2008). Some animals also die from ingestion of agrochemicals, and human response when wandering into farmland and villages; these could be significant for already isolated and reduced populations (Choudhury 2002).

Throughout the range, diseases, particularly rinderpest and foot-and-mouth disease, transmitted by domestic cattle are a potentially serious threat. Foot-and-mouth is the most frequent, but rinderpest has had a particularly dramatic impact in India and several sub-populations of Gaur were nearly destroyed as a result of the disease in 1968 (Krishnan 1972; Pal and Guin 1986; Choudhury 2002), while in Bhadra, it nearly wiped out Gaur populations in 1988–1989, when nearly 800 individuals died (Girish D.V. pers. comm. 2008). In north and central Myanmar anthrax was a major factor in the decline of the species (Salter 1983). Pasha et al. (2004) considered that “in fact no wild animal in India [is] so profoundly influenced by transmitted infections from domestic livestock as Gaur”. There is little research or other evidence to determine impacts of introgression with domestic oxen on Gaur populations, although such factors might be expected to be most serious in India, given the wide overlap of domestic stock with Gaur. Farshid Ahrestani (pers. comm. 2008) saw a Gaur herd of 20 individuals far from human habitation with one domestic ox in the Palni Hills, so it seems likely that introgression occurs to at least some extent.

Srikosamtara and Suteethorn (1995) drew attention to the pressing threats facing Gaur, placing it in the same league of trade-driven threat as better-known species such as Tiger and Asian Elephant, and emphasising the international dimension of trade. Subsequently, the population collapse in Malaysia seems to have been driven by hunting teams from Lao PDR and Thailand (as proven by language at hunting camps in Temenggor), co-opting local Malaysian associates (A.J. Lynam pers. comm. 2008). It is reasonable to expect that when returns in Malaysia drop (as they probably have done already) these teams may turn their attention to other countries’ Gaur populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Loss of habitat, hunting, competition with domestic livestock."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although Indian populations of the gaur have remained fairly stable in recent years, elsewhere the species has shown a worrying decline, especially in Indochina (1). Hunting, particularly for the horns, remains a serious threat to survival and is particularly pertinent when coupled with the widespread habitat loss that is sweeping through much of Asia (1). In addition, gaurs are at risk from diseases that are transmitted by domestic cattle, such as rinderpest and foot-and-mouth (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Gaur is listed in CITES Appendix I, and is legally protected in all range states. It occurs in many protected areas, although in north-east India, Myanmar, China, Lao PDR, Viet Nam and Malaysia many such areas retain only tiny populations or have already lost the species.

South and central India have a well established network of wildlife refuges and protection activities, to a large extent, are effective in many of them (Farshid Ahrestani pers. comm. 2008). However, conservation-oriented research and interventions on Gaur are limited and seem unlikely to expand much in the short-term, meaning that the species benefits largely through general protection activities (particularly those focused around Tiger and Asian Elephant), while species-specific negative factors or worrying long-term trends are likely to go unmanaged and even unnoticed (Farshid Ahrestani pers. comm. 2008). The chief of these seems to be competitive interaction with grazing stock: Gaur densities were the most depressed of all ungulates surveyed by Madhusudan (2004), perhaps reflecting higher niche overlap with domestic cattle than shown by the others (chiefly deer). There is long-term monitoring of some Gaur populations, for instance Mudumalai, Bandipur, Bhadra and Nagarahole (Farshid Ahrestani pers. comm. 2008). Rinderpest has reportedly been eradicated from India (Choudhury 2002). Choudhury (2002) listed proposed aspects of protected area expansion and consolidation to slow further fragmentation of Gaur populations in southern and central India.

In some protected areas (recent examples being Bhadra and Kudremukh in Karnataka), formerly forest-dwelling human communities have resettled closer to markets, clinics, school and other services (Karanth and Karanth 2007). This expands habitat available to Gaur (that which was formerly fields and houses) but more significant is the removal of a source of hunters and the cessation of grazing competition with domestic stock (see Karanth et al. 2006). Such conservation interventions have helped recovery of Gaur populations in this region. Increasing development aspirations mean that out migration is likely from further areas, e.g. Mudumalai (Farshid Ahrestani pers. comm. 2008).

As the majority of the Gaur population is in South Asia, conservation activities are important there. It is also important that populations are maintained at least in several areas in Southeast Asia, to maintain Gaur presence through its historical range, to preserve Gaur genetic diversity and through its importance to the ecosystems within which it lives. Given the regional pattern of threats and current successes to date, implementing effective conservation interventions is considerably more challenging, and therefore a higher priority in the Southeast Asian region.

Gaur occurs mainly in protected areas in Southeast Asia, although Cambodia and Myanmar may both have large populations outside them and some may persist is such areas in Lao PDR (Duckworth 1996; Hansel 2004). In most protected areas of Lao PDR, Viet Nam and Cambodia which still retain Gaur, protected status offers little, if any, real protection to the species, exceptions being Cat Tien National Park in Viet Nam, the Srepok Wilderness Area and the Siema Biodiversity Conservation Area in Cambodia; in the latter two Cambodian areas, there are now even signs of population recovery (R.J. Timmins pers. comm. 2008), as there are at Huai Kha Khaeng Wildlife Sanctuary and Thung Yai Naresuan Wildlife Sanctuary, Thailand, with effective tackling of poaching (R. Steinmetz pers. comm. 2008). Huai Kha Khaeng Wildlife Sanctuary and Thung Yai Naresuan Wildlife Sanctuary form part of Thailand’s ‘Western Forest Complex’ which if these recent gains are consolidated will, in the long term, hold the largest functional Gaur population in Thailand and perhaps South-east Asia.

The most important conservation measure for the species in Cambodia is the continued strengthening and support of conservation efforts in Siema Biodiversity Conservation Area and the Srepok Wilderness Area, and to a lesser extent support of protected area conservation management in the northern plains and central Cardamoms. Likewise in Viet Nam, the most important conservation measure is the continued support of protection efforts within Cat Tien National Park, in Thailand it is to continue the consolidation of the ‘Western Forest Complex’ and to continue the high-intensity protection of the rebuilt herd in Khao Paeng Ma reforestation site, adjacent to Khao Yai National Park. In Myanmar the Hukaung Valley is an exceptional area of lowland plains forest, grassland, and wetlands. Part lies within the Wildlife Sanctuary and some of the rest of the outstanding plains habitat is within an enormous proposed extension. Through its size and mostly little-encroached condition, this is the most outstanding remaining landscape-level floodplains habitat for very large mammals remaining in tropical Asia, and although wildlife populations are highly depleted, warrants the strongest effort to conserve it. It faces a number of daunting challenges (J.W. Duckworth pers. comm. 2008). In Lao PDR, any of a large number of areas could become key Gaur conservation sites, but there is as yet no precedent in the country for effective conservation of high-trade-value large mammals. Xe Pian, Nam Et–Phou Louey, and Nakai–Nam Theun NPAs could all be highly significant areas for the species (Duckworth and Hedges 1998; Steinmetz 2004; Johnson et al. 2006) but so could almost any other NPA; the reality is that the most success with Gaur conservation is likely to come through identifying areas with positive underlying situations to achieve conservation, rather than identifying the area with the most intrinsic importance for Gaur as the focus for efforts. Choudhury (2002) listed aspects of protected area expansion and consolidation to slow further fragmentation of Gaur populations in north-east India, Nepal, and Bhutan, and perhaps allow repopulation of Bangladesh.

The most important actions in Malaysia are to determine if any viable population remains in the country and, if so, to implement effective anti-poaching measures and to work at the policy level to allow effective control of large mammal hunting and trading. Under the current circumstances, any site-based activities are likely to require the sort of 24-hour security employed at the reforestation site adjacent to Khao Yai National Park, Thailand, which has allowed a rapid population growth of Gaur. It may also require reintroduction. The Department of Wildlife and National Parks have a breeding population of captive Gaur in enclosures in the Jenderak ranger station (within Krau Wildlife Reserve), for captive release.

A large captive population exists of wild-type Gaur (as well as of Mythun); given the complexity of field conservation of large ungulates, particularly in South-east Asia, it is clearly in resolving issues of hunting, trade, and protected area effectiveness that conservation interventions must focus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The gaur is protected in all of the countries within which it occurs, international trade is also banned by the listing of this species on Appendix I of the Convention on International Trade in Endangered Species (CITES) (1). Gaurs are found in a number of protected reserves such as the Royal Chitwan National Park in Nepal and a large captive population exists (1). With careful monitoring of population trends and the protection of remaining habitat, the future of these formidable cattle is relatively stable at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gaur

This article is about the bovine animal. For other uses, see Gaur (disambiguation).
Not to be confused with Gaur, West Bengal.

The gaur (/ˈɡaʊər/, Bos gaurus), also called Indian bison, is the largest extant bovine and is native to South Asia and Southeast Asia. The species is listed as vulnerable on the IUCN Red List since 1986, as the population decline in parts of the species' range is likely to be well over 70% during the last three generations. Population trends are stable in well-protected areas, and are rebuilding in a few areas which had been neglected.[1]

The gaur is the tallest species of wild cattle.[2] The Malayan gaur is called seladang, and the Burmese gaur is called pyoung ပြောင်.[3]

The domesticated form of the gaur Bos frontalis is called gayal or mithun.[4]

Characteristics[edit]

Gaur bull with the typical high dorsal ridge
Dimensions of gaur horns

The gaur is a strong and massively built species with a high convex ridge on the forehead between the horns, which bends forward, causing a deep hollow in the profile of the upper part of the head. There is a prominent ridge on the back. The ears are very large; the tail only just reaches the hocks, and in old bulls the hair becomes very thin on the back. In colour, the adult male gaur is dark brown, approaching black in very old individuals; the upper part of the head, from above the eyes to the nape of the neck, is, however, ashy grey, or occasionally dirty white; the muzzle is pale coloured, and the lower part of the legs are pure white or tan. The cows and young bulls are paler, and in some instances have a rufous tinge, which is most marked in groups inhabiting dry and open districts. The tail is shorter than in the typical oxen, reaching only to the hocks. They have a distinct ridge running from the shoulders to the middle of the back; the shoulders may be as much as 12 cm (4.7 in) higher than the rump. This ridge is caused by the great length of the spinous processes of the vertebrae of the fore-part of the trunk as compared with those of the loins. The hair is short, fine and glossy, and the hooves are narrow and pointed.[2]

The gaur has a head-and-body length of 250 to 330 cm (8.2 to 10.8 ft) with a 70 to 105 cm (28 to 41 in) long tail, and is 165 to 220 cm (5.41 to 7.22 ft) high at the shoulder. The average weight is 650 to 1,000 kg (1,430 to 2,200 lb), with an occasional large bull weighing up to 1,500 kg (3,300 lb).[5] Males are about one-fourth larger and heavier than females.[4] In general measurements are derived from gaurs surveyed in India and China. The Seladang, or Malayasian subspecies, may average larger but no scientifically published measurements are known.[6][7]

Gaur do not have a distinct dewlap on the throat and chest. Both sexes carry horns, which grow from the sides of the head, curving upwards. Between the horns is a high convex ridge on the forehead. At their bases they present an elliptical cross-section, a characteristic that is more strongly marked in bulls than in cows. The horns are decidedly flattened at the base and regularly curved throughout their length, and are bent inward and slightly backward at their tips. The colour of the horns is some shade of pale green or yellow throughout the greater part of their length, but the tips are black.[2] The horns, of medium size by large bovid standards, grow to a length of 60 to 115 cm (24 to 45 in).[4]

The cow is considerably lighter in make and in colour than the bull. The horns are more slender and upright, with more inward curvature, and the frontal ridge is scarcely perceptible. In young animals the horns are smooth and polished. In old bulls they are rugged and dented at the base.[8]

Gaur are among the largest living land animals. Only elephants, rhinos, the hippopotamus and the giraffe consistently grow heavier. Two species that naturally co-exist with the gaur are heavier: the Asian elephant and Indian rhinoceros.[9][10] By most standards of measurements, gaur is the largest wild bovid alive today. However, the shorter-legged, bulkier Wild water buffalo is similar in average body mass, if not maximum weight.[5][11]

Distribution and habitat[edit]

Malayan gaur locally called seladang
Indian Gaur in Bandipur National Park

Gaur historically occurred throughout mainland South and Southeast Asia, including Vietnam, Cambodia, Laos, China, Thailand, Peninsular Malaysia, Myanmar, India, Bangladesh, Bhutan, and Nepal. Today, the species is seriously fragmented within its range, and regionally extinct in Sri Lanka.[1]

Gaur are largely confined to evergreen forests or semi-evergreen and moist deciduous forests, but also occur in deciduous forest areas at the periphery of their range. Gaur habitat is characterized by large, relatively undisturbed forest tracts, hilly terrain below an altitude of 5,000 to 6,000 ft (1,500 to 1,800 m), availability of water, and an abundance of forage in the form of grasses, bamboo, shrubs, and trees. Their apparent preference for hilly terrain may be partly due to the earlier conversion of most of the plains and other low-lying areas to croplands and pastures.[12] They occur from sea level to an altitude of at least 2,800 m (9,200 ft). Low-lying areas seem to comprise optimal habitat.[13]

In Vietnam, several areas in Đắk Lắk Province were known to contain gaur in 1997.[14] Several herds persist in Cát Tiên National Park and in adjacent state forest enterprises.[15] The current status of the gaur population is poorly known; they may be in serious decline.[1]

In Cambodia, gaur declined considerably in the period from the late 1960s to the early 1990s. The most substantial population of the country remained in Mondulkiri Province, where up to 1000 individuals may have survived in a forested landscape of over 15,000 km2 (5,800 sq mi).[16] Results of camera trapping carried out in 2009 suggested a globally significant population of gaur in the Mondulkiri Protected Forest and the contiguous Phnom Prich Wildlife Sanctuary.[17]

In Laos, up to 200 individuals were estimated to inhabit protected area boundaries in the mid–1990s.[18] They were reported discontinuously distributed in low numbers. Overhunting had reduced the population, and survivors occurred mainly in remote sites. Fewer than six National Biodiversity Conservation Areas held more than 50 individuals. Areas with populations likely to be nationally important included the Nam Theun catchment and the adjoining plateau.[19] Subsequent surveys carried out a decade later using fairly intensive camera trapping did not record any gaur any more, indicating a massive decline of the population.[1]

In China, gaur occur in heavily fragmented populations in Yunnan and southeast Tibet. By the 1980s, they were extirpated in Lancang County, and the remaining animals were split into two populations, viz. in XishuangbannaSimao and Cangyuan. In the mid-1990s, a population of 600–800 individuals may have lived in Yunnan Province, with the majority occurring in Xishuangbanna National Nature Reserve.[1]

In Thailand, gaur were once found throughout the country, but less than 1,000 individuals were estimated to have remained in the 1990s. In the mostly semi-evergreen Dong Phayayen – Khao Yai Forest Complex, they were recorded at low density at the turn of the century, with an estimated total of about 150 individuals.[20]

In Bangladesh, a few gaur were thought to occur in the Chittagong Hill Tracts, Sylhet, and Mymensingh areas in the early 1980s, but none had been seen in Pablakhali Wildlife Sanctuary situated in the Hill Tracts since the early 1970s.[21] Individuals from Mizoram and Tripura cross into Bangladesh.[13]

In Bhutan, they apparently persist all over the southern foothill zone, notably in Royal Manas National Park, Phibsoo Wildlife Sanctuary and Khaling Wildlife Sanctuary.[13]

In Nepal, the gaur population was estimated to be 250–350 in the mid-1990s, with the majority in Chitwan National Park and the adjacent Parsa Wildlife Reserve. Population trends appeared to be relatively stable.[1] The Chitwan population has increased from 188 to 296 animals in the years 1997 to 2007; a census conducted in Parsa Wildlife Reserve confirmed the presence of 37 gaur in May 2008.[22]

In India, the population was estimated to be 12,000–22,000 in the mid-1990s. The Western Ghats and their outflanking hills in southern India constitute one of the most extensive extant strongholds of gaur, in particular in the WayanadNagarholeMudumalaiBandipur complex.[23] The populations in India, Bhutan and Bangladesh are estimated to comprise 23,000–34,000 individuals.[13] Major populations of about 2,000 individuals have been reported in both Nagarahole and Bandipur National Parks, over 1,000 individuals in Tadoba Andhari Tiger Project, 500–1000 individuals in both Periyar Tiger Reserve and Silent Valley and adjoining forest complexes, and over 800 individuals in Bhadra Wildlife Sanctuary.[1]

Ecology and behaviour[edit]

Where gaur have not been disturbed, they are basically diurnal. In other areas, they have become largely nocturnal due to forest molestation caused by people. In central India, they are most active at night, and are rarely seen in the open after 8 o'clock in the morning. During the dry season, herds congregate and remain in small areas, dispersing into the hills with the arrival of the monsoon. While gaur depend on water for drinking, they do not seem to bathe or wallow.[4]

In January and February, gaur live in small herds of eight to 11 individuals, one of which is a bull. In April or May, more bulls may join the herd for mating, and individual bulls may move from herd to herd, each mating with many cows. In May or June, they leave the herd and may form herds of bulls only or live alone. Herds wander 2–5 km (1.2–3.1 mi) each day. Each herd has a nonexclusive home range, and sometimes herds may join in groups of 50 or more.[24] The average population density is about 0.6 animals per square kilometre (1.5 animals per square mile), with herds having home ranges of around 80 km2 (31 sq mi).[citation needed]

Gaur herds are led by an old adult female, the matriarch. Adult males may be solitary. During the peak of the breeding season, unattached males wander widely in search of receptive females. No serious fighting between males has been recorded, with size being the major factor in determining dominance. Males make a mating call of clear, resonant tones which may carry for more than 1.6 km (0.99 mi). Gaur have also been known to make a whistling snort as an alarm call, and a low, cow-like moo.[25]

In some regions in India where human disturbance is minor, the gaur is very timid and shy. When alarmed, gaur crash into the jungle at a surprising speed. However, in Southeast Asia and South India, where they are used to the presence of humans, gaur are said by locals to be very bold and aggressive. They are frequently known to go into fields and graze alongside domestic cattle, sometimes killing them in fights. Gaur bulls may charge unprovoked, especially during summer, when the intense heat and parasitic insects make them more short-tempered than usual. To warn other members of its herd of approaching danger, the gaur lets out a high whistle for help.[8]

Feeding[edit]

Wild gaur graze and browse on a wider variety of plants than any other ungulate species of India, with a preference for the upper portions of plants, such as leaf blades, stems, seeds and flowers of grass species, including kadam.[26]

During a survey in the Bhagwan Mahaveer Sanctuary and Mollem National Park, 32 species of plants were identified as food for gaur. They consume herbs, young shoots, flowers, fruits of elephant apple with a high preference for leaves. Food preference varies by season. In winter and monsoon, they feed on preferably fine and fresh grasses and herb species of the legume family, such as tick clover, but also browse on leaves of shrub species such as karvy, Indian boxwood, mallow-leaved crossberry, East-Indian screw tree and chaste tree. In summer, they also feed on bark of teak, on fruit of golden shower tree, and on the bark and fruit of cashew. Gaur spent most of their daily time feeding. Peak feeding activity was observed between 6:30 and 8:30 am and between 5:30 and 6:45 pm. During the hottest hours of the day, 1:30 to 3:30 pm, they rest in the shade of big trees.[27]

They may debark trees due to shortages of preferred food, and of minerals and trace elements needed for their nutrition, or for maintaining an optimum fiber/protein ratio for proper digestion of food and better assimilation of nutrients. They may turn to available browse species and fibrous teak bark in summer as green grass and herbaceous resources dry up. High concentrations of calcium (22400 ppm) and phosphorus (400 ppm) have been reported in teak bark, so consumption of teak bark may help animals to satisfy both mineral and other food needs. Long-term survival and conservation of these herbivores depend on the availability of preferred plant species for food. Hence, protection of the historically preferred habitats used by gaur is a significant factor in conservation biology.[27]

Reproduction[edit]

Gaur have one calf (or occasionally two) after a gestation period of about 275 days, about nine months, a few days less than domestic cattle. Calves are typically weaned after seven to 12 months. Sexual maturity occurs in the gaur's second or third year. Breeding takes place year-round, but typically peaks between December and June. The lifespan of a gaur in captivity is up to 30 years.[24]

Natural enemies[edit]

Due to their formidable size and power, gaur have few natural enemies. Leopards and dhole packs occasionally attack unguarded calves or unhealthy animals, but only the tiger and the saltwater crocodile have been reported to kill a full-grown adult. The habitat of gaurs and saltwater crocodiles seldom overlaps in recent times due to the decreasing range of both species. Tigers hunt young or infirm gaur, but have been reported to have also killed healthy bulls weighing at least 1,000 kg (2,200 lb).[28] When confronted by a tiger, the adult members of a gaur herd often form a circle surrounding the vulnerable young and calves, shielding them from the big cat. A herd of gaur in Malaysia encircled a calf killed by a tiger and prevented it from approaching the carcass.[12] In Nagarahole National Park, upon sensing a stalking tiger, a herd of gaur walked as a menacing phalanx towards it, forcing the tiger to retreat and abandon the hunt. Gaur are not as aggressive toward humans as wild water buffaloes.[29]

There are several cases of tigers being killed by gaur. In one instance, a tiger was repeatedly gored and trampled to death by a gaur during a prolonged battle.[30] A large male tiger carcass was found beside a small, broken tree in Nagarahole National Park, having been fatally struck against the tree by a large bull gaur a few days earlier.[31]

Threats[edit]

In Laos, gaurs are highly threatened by poaching for trade to supply international markets, but also by opportunistic hunting, and specific hunting for home consumption.[19] In the 1990s, they were particularly sought by Vietnamese poachers for their commercial value.[18]

In Thailand, gaurs are highly threatened by poaching for commercial trade in meat and trophies.[20]

Conservation[edit]

Bos gaurus is listed in CITES Appendix I, and is legally protected in all range states.[1]

In captivity[edit]

A captive gaur at Arignar Anna Zoological Park, Chennai
  • On 2 August 2011, a 17-year old male gaur named "Mani" was found gored to death in his enclosure, by a younger male allegedly over fight for mate at the Arignar Anna Zoological Park, Chennai. The zoo officials reported Mani was the oldest of the herd of gaur living in the zoo, and added that this is an unusual incident.[32]
  • On 8 January 2001, the first cloned gaur was born at Trans Ova Genetics in Sioux Center, Iowa. The calf was carried and brought successfully to term by a surrogate mother, a domestic cow. While healthy at birth, the calf died within 48 hours of a common dysentery, most likely unrelated to cloning.[33]

Taxonomic history[edit]

Bos gaurus grangeri skeleton
Leucistic gaur or Manjampatti white bison. Leucistic gaur are very rare; this photograph is taken from Chinnar Wildlife Sanctuary.

In his first description of 1804, Aylmer Bourke Lambert applied the binomial Bos frontalis to a domestic specimen probably from Chittagong. In 1827, Charles Hamilton Smith applied the binomial Bos gaurus to the wild species occurring near Mainpat in the Sarguja Tributary States of India. Later authors subordinated the species under either Bos or Bibos.[34]

In 2003, the International Commission on Zoological Nomenclature has fixed the first available specific name based on a wild population that the name for this wild species is valid by virtue of its being antedated by a name based on a domestic form. Most authors have adopted the binomial Bos gaurus for the wild species as valid for the taxon.[35]

Traditionally, three subspecies of Bos gaurus have been recognized:

  • B. g. gaurus described by Smith in 1827 from central India;[34] ranging to Nepal and Bhutan;[36]
  • B. g. readei described by Lydekker in 1903 from the hill forests of Upper Burma as ranging to Tenasserim;[36]
  • B. g. hubbacki described by Lydekker in 1907 from Pahang as ranging in peninsular Malaysia and probably northward to Tenasserim.[36]

This classification, based largely on differences in coloration and size, is no longer widely recognized.[37]

In recognition of phenotypic differences between Indian and Southeast Asian specimens, the trinominals Bos gaurus gaurus and Bos gaurus laosiensis are provisionally accepted pending further morphometric and genetic study.[1]

Etymology[edit]

The Sanskrit word गौर gaura means white, yellowish, reddish. The Sanskrit word gaur-mriga means a kind of buffalo.[38]

The Hindi word गौर gaur means fair-skinned, fair, white.[39]

In popular culture[edit]

  • The gaur is the State Animal of the State of Goa in India.[40]
  • The Red Gaurs (Thai: กระทิงแดง Krathing Daeng ) were an extreme right-wing paramilitary organization active in Thailand during the 1970s.
  • "Krating Daeng" today is a brand of energy drink featuring a pair of charging red gaur bulls in the logo; also used on the licensed derivative, "Red Bull".

See also[edit]

References[edit]

  1. ^ a b c d e f g h i j Duckworth, J.W., Steinmetz, R., Timmins, R.J., Pattanavibool, A., Than Zaw, Do Tuoc, Hedges, S. (2008). "Bos gaurus". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. 
  2. ^ a b c Lydekker, R. (1888–1890). The new natural history Volume 2. Printed by order of the Trustees of the British Museum (Natural History), London.
  3. ^ Hubback, T. R. (1937). The Malayan gaur or seladang. Journal of Mammalogy 18 (3): 267–279.
  4. ^ a b c d Nowak, R. M. (1999). Gaur Pages 1158–1159 in Walker's Mammals of the World. Volume 1. The Johns Hopkins University Press, Baltimore, USA and London, UK.
  5. ^ a b Smith, A. T., Xie, Y. (eds.) (2008). A Guide to the Mammals of China. Princeton University Press, Princeton Oxforshire. Page 472.
  6. ^ Hubback, T. R. (1937). The Malayan gaur or seladang. Journal of Mammalogy: 267-279.
  7. ^ Ogilvie, C. S. (1953). The behaviour of seladang (Bibos gaurus). Oryx 2 (03): 167-169.
  8. ^ a b Sanderson, G. P. (1907). "XVIII, XVIV". Thirteen Years Among the Wild Beasts of India: Their Haunts and Habits from Personal Observation (6th ed.). Edinburgh: John Grant. pp. 243–265. 
  9. ^ Schaller, G. B., Simon, N. M. (1969). The endangered large mammals of Asia. In: Holloway, C. W. (ed.) IUCN Eleventh Technical Meeting. Papers and Proceedings, 25-28 November 1969, New Delhi, India. Volume II. IUCN Publications new series No. 18, Morges, Switzerland. Pp. 11-23.
  10. ^ Hislop, J. A. (1966). Rhinoceros and seladang—Malaya's vanishing species. Oryx 8 (06): 353-359.
  11. ^ Owen-Smith, R. N. (1992). Megaherbivores: the influence of very large body size on ecology. Cambridge University Press.
  12. ^ a b Schaller, G. (1967). The Deer and the Tiger: a study of wildlife in India. University of Chicago Press, Chicago
  13. ^ a b c d Choudhury, A. (2002). Distribution and conservation of the Gaur Bos gaurus in the Indian Subcontinent. Mammal Review 32: 199–226.
  14. ^ Le Xuan Canh, Pham Trong Anh, Duckworth, J. W., Vu Ngoc Thanh, Lic Vuthy (1997). A survey of large mammals in Dak Lak Province, Viet Nam. Unpublished report to IUCN and WWF. Hanoi, Viet Nam.
  15. ^ Polet, G..Ling, S. (2004). Protecting mammal diversity: opportunities and constraints for pragmatic conservation management in Cat Tien National Park, Vietnam. Oryx 38 (2): 186
  16. ^ Tordoff, A. W., Timmins, R. J., Maxwell, A., Huy Keavuth, Lic Vuthy, Khou Eang Hourt (eds.) (2005). Biological assessment of the Lower Mekong Dry Forests Ecoregion. WWF Greater Mekong Programme. Phnom Penh, Cambodia.
  17. ^ Channa, P., Sovanna, P., Gray, T. N. E. (2010). Recent camera trap records of globally threatened species from the Eastern Plains Landscape, Mondulkiri. Cambodian Journal of Natural History 2010 (2): 89–93.
  18. ^ a b Timmins, R. J., Evans, T. D. (1996). Wildlife and Habitat Survey of the Nakai-Nam Theun National Biodiversity Conservation Area, Khammouan and Bolikhamsai Provinces, Lao PDR. A report to Centre for Protected Areas and Watershed Management, Department of Forestry, Vientiane, Lao PDR.
  19. ^ a b Duckworth, J. W., Salter, R. E. and Khounboline, K. (compilers) (1999). Wildlife in Lao PDR: 1999 Status Report. Vientiane: IUCN – The World Conservation Union / Wildlife Conservation Society / Centre for Protected Areas and Watershed Management.
  20. ^ a b Lynam, A. J., Round, P. and Brockelman, W. Y. (2006). Status of birds and large mammals of the Dong Phayayen-Khao Yai Forest Complex, Thailand. Biodiversity Research and Training Program and Wildlife Conservation Society, Bangkok, Thailand.
  21. ^ Khan, M. A. R. (1985). Future conservation priorities for Bangladesh. Paper prepared for the 25th working session of IUCN's Commission on National Parks and Protected Areas, 4–8 February 1985. Corbett National Park, India
  22. ^ WWF Nepal (2008). Gaur count in Parsa Wildlife Reserve. EcoCircular Newsletter Vol. 44 No. 8, June 2008
  23. ^ Ranjitsinh, M. K. (1997) Beyond the Tiger: Portraits of Asian Wildlife. Birajbasi Printers, New Delhi, India.
  24. ^ a b Burton, R. (2002). International Wildlife Encyclopedia (3 ed.). Marshall Cavendish. pp. 936–938. ISBN 978-0-7614-7266-7. 
  25. ^ Huffman, B. (2004). "Bos frontalis – Gaur". ultimateungulate.com. 
  26. ^ Shukla, R., Khare, P. K. (1998). Food habits of wild ungulates and their competition with live stock in Pench Wildlife Reserve central India. Journal of the Bombay Natural History Society 95(3): 418–421.
  27. ^ a b Gad, S. D.; Shyama, S. K. (2009). "Studies on the food and feeding habits of Gaur Bos gaurus H. Smith (Mammalia: Artiodactyla: Bovidae) in two protected areas of Goa". Journal of Threatened Taxa 1 (2): 128–130. doi:10.11609/jott.o1589.128-30. 
  28. ^ Hunter, L. (2011). Carnivores of the World. Princeton University Press, Princeton. ISBN 9780691152288
  29. ^ Perry, R. (1965). The World of the Tiger. p. 260. ASIN: B0007DU2IU. 
  30. ^ Sunquist, M., Sunquist, F. (2002). Wild Cats of the World. University Of Chicago Press, Chicago
  31. ^ Karanth, U., Nichols, J., Kumar, N. S., Link, W. A., Hines, J. E. (2002). Monitoring Tigers and Their Prey: a manual for researchers, managers, and conservationists. Proceedings of the National Academy of Sciences 101 (14): 4854–4858.
  32. ^ "Bison lock horns in Vandalur zoo, older one gored to death". The Times Of India. 3 August 2011. 
  33. ^ Advanced Cell Technology, Inc. (2001). "Press Release - First cloned endangered animal was born at 7:30 pm on Monday, 8 January 2001". Archived from the original on 31 May 2008. 
  34. ^ a b Ellerman, J. R., Morrison-Scott, T. C. S. (1966). Checklist of Palaearctic and Indian mammals 1758 to 1946. Second edition. British Museum of Natural History, London
  35. ^ Gentry, A. Clutton-Brock, J., Groves, C. P. (2004). The naming of wild animal species and their domestic derivatives. Journal of Archaeological Science 31: 645–651
  36. ^ a b c Lydekker, R. (1913). Catalogue of the ungulate mammals in the British Museum (natural history) Volume 1. Printed by order of the Trustees of the British Museum (Natural History), London.
  37. ^ Corbet, G. B., Hill, J. E. (1992). The mammals of the Indomalayan Region: a systematic review. Oxford University Press. ISBN 0-19-854693-9
  38. ^ Macdonell, A. A. (1929). गौर gaura. A practical Sanskrit dictionary with transliteration, accentuation, and etymological analysis throughout. Oxford University Press, London.
  39. ^ Caturvedi, M. (1970). गौर gaur. A practical Hindi-English dictionary. National Publishing House, Delhi. Page 184.
  40. ^ http://veabgoa.org/2013/05/gimps-of-last-surviving-herd-of-state-animal-of-goa/
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!