Articles on this page are available in 1 other language: Arabic (2) (learn more)

Molecular Biology and Genetics

Molecular Biology

Barcode data: Periplaneta fuliginosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGCAACGATGAATATTTTCGACAAATCATAAGGATATTGGAACTTTATACTTCATTTTTGGTGCTTGATCAGGTATAGTAGGAACATCATTGAGAATATTAATTCGTGCTGAGCTTGGTCAACCCGGTTCACTAATTGGAGATGATCAAATTTATAATGTGATTGTAACTGCACATGCTTTCATTATAATTTTCTTTATAGTAATACCAATTATAATTGGTGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCAGATATAGCATTTCCACGAATAAACAATATAAGATTTTGATTATTACCTCCTTCATTAACTCTATTACTAGCAAGCAGTATGGTAGAAAGAGGAGCTGGTACAGGTTGAACAGTATACCCACCATTAGCAAGAGGTATTGCACATGCTGGAGCATCAGTCGACCTAGCAATTTTTTCACTACACTTAGCTGGTGTATCATCAATTTTAGGAGCTGTAAATTTTATTTCAACAACAATTAATATAAAACCAATTAATATAAAACCAGAACGAATTCCACTATTTGTATGATCTGTAGCCATTACAGCCTTATTATTACTATTATCATTACCAGTTCTTGCTGGAGCAATTACAATATTATTAACTGATCGAAATTTAAATACATCTTTCTTTGATCCAGCTGGAGGGGGTGATCCAATCCTTTATCAACATTTATTTTGATTCTTTGGTCACCCAGAAGTATATATTTTAATTTTACCAGGATTTGGAATAATTTCACATATTATTTGTCATGAAAGAGGTAAAAAGGAAGCCTTCGGAAATTTAGGAATAATTTTTGCTATACTAGCAATTGGTTTATTAGGTTTTGTAGTATGAGCTCACCATATATTTACTGTAGGAATGGATGTTGATACACGAGCTTATTTTACATCAGCTACTATAATTATTGCAGTTCCAACAGGAATTAAAATTTTTAGTTGACTAGCCACTGTATATGGTTCTCAATTATCATATAGAGCACCATGCTTATGATCATTAGGATTTGTATTTCTATTCACTATTGGAGGTTTAACAGGAGTTGTATTAGCAAATTCATCAATTGATATTGTATTACATGATACTTATTATGTTGTAGCTCACTTCCACTATGTATTGTCAATAGGGGCAGTATTTGCAATTATAGCAGGTTTTATTCAATGATACCCTTTATTTACAGGTTTAACTATAAATCCAAAATGATTAAAAGCACAATTTGCAATTATATTTATTGGAGTAAATATAACATTTTTTCCACAACATTTTCTTGGATTGGCTGGTATACCTCGACGTTATTCAGATTATCCAGATGCTTACACAGCATGAAATGTAGTATCATCAATTGGATCAATAATCTCATTTATTGGAGTATTAATATTTATTTTTATTATATGAGAAAGAATAAGATCTAATCGACAAATTTTATTTCCAACACAAACGAGAAATTCAATTGAATGATTACAAAATCTACCACCTGCAGAGCATAGATATTCAGAATTACCAACAATTACTAGTTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Periplaneta fuliginosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Smokybrown cockroach

The smokybrown cockroach (Periplaneta fuliginosa) is a large species of cockroach, winged, and growing to a length of 1¼–1⅜ in.

Contents

Characteristics

Underside of P. americana

Although closely related to the American cockroach (Periplaneta americana), the smokybrown cockroach is readily distinguishable from it by its uniformly dark brown–mahogany coloration. Furthermore, unlike the American cockroach, which possess a light-rimmed pattern on its thorax, the smokybrown cockroach's thorax is dark and shiny.

Diet

The smokybrown cockroach is a detritivore and can feed off a wide array of organic (including decaying) matter. Like most cockroaches, it is a scavenger. It tends to lose more moisture than its relatives and requires water every 2–3 days.

Behaviour

The smokybrown cockroach may come indoors to look for food and even to live; generally, however, in warm weather, it will move outdoors.[1]

Habitat

The smokybrown cockroach is very common in Japan, as well as the southern United States and tropical climates; notably, it can be found in Florida, Louisiana, Mississippi, Texas, and other moist Gulf coastal states, and along the southern Mississippi River.

The smokybrown cockroach prefers warmer climates and is not cold-tolerant. It may, however, be able to survive colder climates by going indoors. In addition to this, it fares well in moist conditions and appears to be particularly prevalent in moist concealed areas. It often lives around the perimeter of buildings.

References

  1. ^ Grimaldi D., Engel M.S. (2005.) Evolution of the Insects, Cambridge University Press, New York City, NY, USA.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!