Articles on this page are available in 1 other language: Arabic (15) (learn more)

Overview

Distribution

Elliptorhina laevigata, the Madagascar hissing cockroach, occurs only on the the island of Madagascar.

Biogeographic Regions: ethiopian (Native )

Other Geographic Terms: island endemic

  • Guthrie, D., A. Tindall. 1968. The Biology of the Cockroach. London: Edward Arnold Publishers Ltd..
  • Yoder, J., N. Grojean. 1997. Group Influence on Water Conservation in the Giant Madagascard Hissing-Cockroach, Gromphdorhina portentosa (Dictyoptera: Blaberidae). Blackwell Science, 22: 79-82.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Like most insects, Elliptorhina laevigata has a head, thorax, abdomen, and 6 legs. Unlike many cockroach species, they do not possess wings. Their exoskeleton is dark, from mahogany brown to black, and very thick, hard, and waxy. They have pads and hooks on their feet that allow them to climb smooth surfaces. Males possess a pair of large bumps or tubercles behind their head, these structures are much smaller in females. These horns are known as pronatal humps. Elliptorhina laevigata is one of the largest species of the cockroaches in the world, adults are 5.1 to 10.2 cm long, with males growing larger than females.

Range length: 5.1 to 10.2 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger; sexes shaped differently

  • Clark, D., A. Moore. 1995. Genetic Aspects of Communication During Male Competition in the Madagascar Hissing Cockroach: Honest Signalling of Size. Heredity, 75: 198-205.
  • Milius, S. 2002. Meeting Danielle the Tarantula. Science News, 161/6: 90-92.
  • Miller, J. 1977. Society for the Science and the Public. Science News, 112/21: 344.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Elliptorhina laevigata is primarily found in the tropical lowland rainforests of Madagascar. They tend to live in the dry litter on the forest floor.

Range elevation: 0 to 1000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

  • Copeland, M. 2003. Cockroach. London: Reaktion Books.
  • Ryan, J., G. Creighton, L. Emmons. 1993. Activity Patterns of Two Species Nesomys in a Madagascar Rain Forest. Journal of Tropical Ecology, 9: 101-107.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Madagascar hissing cockroaches are detritivores. Their most frequent food is decaying plant material, including fallen fruit, because it is so readily available. They also eat smaller insects and animal carcasses.

Animal Foods: carrion ; insects

Plant Foods: leaves; seeds, grains, and nuts; fruit; lichens

Other Foods: fungus; detritus ; dung

Primary Diet: detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Elliptorhina laevigata plays a role in the rainforests of Madagascar by recycling a large amount of decaying plant and animal matter.

The mite Androlaelaps schaeferi, formerly Gromphadorholaelaps schaeferi, is a common parasite of this cockroach. These mites form small clumps of four to six individuals at the base of the leg of their cockroach host. While it was originally thought that this mite was sanguinivorous (blood-sucking), recent studies showed that the mite simply "shares" in a cockroach's food items.

Ecosystem Impact: biodegradation

Commensal/Parasitic Species:

  • Yoder, J., J. Barcelona. 1995. Food and water resources used by the Madagascan hissing-cockroach mite, Gromphadorholaelaps schaeferi. Experimental and Applied Acarology, 19/5: 259-273.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hissing cockroaches probably have many types of predators, but there are few documented relationships. Arachnids, ants, tenrecs, and some ground-feeding birds are likely predators. As previously mentioned, an anti-predatory strategy is an alarm hiss - producing a loud snake-like noise that may startle potential predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The Madagascar hissing cockroach is unique in its ability to make a "hissing" sound. These cockroaches hiss through the breathing spiracles located on their abdomens. This hissing sound is used to communicate with its own species and others. Four hisses with different social purposes and amplitude patterns have been identified: a male combat hiss, two types of courting and mating hisses, and an alarm hiss (a loud snake-like hissing that startles predators).

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Clark, D., A. Moore. 1995. Social Communication in the Madagascar Hissing Cockroach: Features of Male Courtship Hisses and a Comparison of Courtship and Agonistic Hisses. Behavior, 132: 5-6.
  • Clopton, R. 1995. Hissing Cockroach, Gromphadorhina portentosa. Invertebrate Biology, 114/4: 271-278.
  • Nelson, M., J. Fraser. 1980. Sound Production in the Cockroach, Gromphadorhina portentosa: Evidence for Communication by Hissing. Behavioral Ecology and Sociobiology, 6/4: 305-314.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Madagascar hissing cockroachs have an incomplete or partial metamorphosis. They hatch from eggs as nymphs, which are quite similar to adults in general structure, but lack reproductive organs. Nymphs molt their exoskeleton six times as they grow to adulthood, a process that usually takes 6-7 months.

Development - Life Cycle: metamorphosis

  • Fraser, J., M. Nelson. 1984. Communication in the Courtship of the Madagascan Hissing Cockroach: Normal Courtship. Animal Behavior, 32: 194-203.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Madagascar hissing cockroaches can live up to five years.

Range lifespan

Status: wild:
5 (high) years.

Range lifespan

Status: captivity:
5 (high) years.

Typical lifespan

Status: wild:
2 to 5 years.

Typical lifespan

Status: captivity:
2 to 5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male Madagascar hissing cockroaches produces acoustic sounds or hissing during courtship interactions with females. Males typically produce two types of signals, a calling sound and a courtship sound. The calling sound is a long distance song that is used to attract females while the courtship sound is used more during close range interaction.

Adult male hissing cockroaches defend mating territories from other males, and attempt to monopolize mating with all the females in their territory. Males interact by hissing, and in bouts of pushing and shoving. Cockroach mating can occur year around, but only when the climate is warm.

Mating System: polygynous ; polygynandrous (promiscuous)

Male hissing cockroaches are attracted and stimulated by the odor of the female. The males have specialized sense organs on their antennae for this. The amount of sex attractant secreted is higher in virgin females, although the output can be sporadic. It decreases with age. When the male is attracted to the female by this scent, he begins to hiss and touch her antennae. The pair then attaches to one another and turn rear to rear and remain in this position for 30 minutes. The females carry the ootheca, a long yellowish egg case, internally and they release the young nymphs after the eggs have hatched. Typically 15 - 40 cockroach nymphs will emerge.

Breeding interval: year-round

Breeding season: year-round

Range number of offspring: 15 to 40.

Average gestation period: 2 months.

Range time to independence: 5 to 10 months.

Average age at sexual or reproductive maturity (female): 7 months.

Average age at sexual or reproductive maturity (male): 7 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

Female Madagascar hissing cockroaches provision their eggs, then carry them after fertilization until they hatch.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female)

  • Clark, D., A. Moore. 1994. Social Interactions and Aggression Among Male Madagascar Hissing Cockroaches (Gromphadorhina portentosa) in Groups (Dictyoptera: Blaberidae). Journal of Insect Behavior, 7/2: 199-215.
  • Guthrie, D., A. Tindall. 1968. The Biology of the Cockroach. London: Edward Arnold Publishers Ltd..
  • Matthews, R., J. Matthews. 1978. Insect Behavior. New York: John Wiley & Sons.
  • Roeder, K. 1963. Nerve Cells and Insect Behavior. Cambridge, Massachusetts: Harvard University Press.
  • Sreng, L. 2005. Cockroach Mating Behaviors, Sex Pheromones, and Abdominal Glands (Dictyoptera: Blaberidae). Journal of Insect Behavior, 6/6: 715-735.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gromphadorhina portentosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGGGCATGAGCAGGAATAGTAGGTACTTCTTTAAGAATACTAATTCGAGCTGAATTAAATCAACCAGGTTCATTGATTGGAGATGACCAGATCTACAATGTAATTGTCACAGCTCACGCTTTTGTAATAATTTTCTTTATGGTTATACCCATTCTTATTGGTGGATTTGGAAACTGATTAGTCCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGTATAAATAATATGAGCTTTTGACTACTTCCCCCCTCCTTAACCTTATTACTAGCAAGAAGTATAGTAGAAAGAGGAGCTGGAACAGGATGAACAGTTTATCCTCCGTTAGCTAGTAATATTGCCCATGCTGGAGCATCAGTTGATTTAGCCATTTTTTCTTTACATTTAGCAGGTGTTTCCTCAATTTTAGGTGCAGTTAACTTTATCTCCACAATTATCAATATAAAACCTATTAATATAACACCTGAACGAATCCCATTATTTGTCTGAGCAGTGGGAATTACAGCCTTATTATTACTTCTCTCACTTCCAGGTCTAGCAGGGGCTATCCCCATACTCTTAACTGATCGAAATTTAAATACCTCATTTTTTGAACCCGGTGGAGGGGGAGACCCCATTTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gromphadorhina portentosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Because the Madagascar hissing cockroach is only found in Madagascar, little conservation efforts have been done. This is due to political turmoil. Since the Malagasy people were forced out by the French colonizers in the 1960’s, the country has gone from dictatorship to dictatorship. It is difficult for field biologists to research the area due to the sparse network of passable roads. In the recent years, Liberation and international aid have made it easier for biologists to study Madagascar focusing on the hissing cockroach. The Madagascar hissing cockroaches huddle together in the forest. These pockets of natural forest are dying by degradation and fragmentation and because of this Madagascar has become a top priority for conservation biologists. Hundreds of millions of dollars have been contributed over the past three decades to help conservation efforts in Madagascar.

CITES: no special status

  • Bohannon, J. 2003. Madagascar Tames the Bohemian of Biology. Science, 301/5641: 1835-1837.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of Gromphadorina portentosa on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is part of the nutrient cycling process in Malagasy forests. These forests are important as sources of timber, for water quality, and sources of other natural products.

Hissing cockroaches are also sold commercially in the pet trade.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Madagascar hissing cockroach

The Madagascar hissing cockroach (Gromphadorhina portentosa), also known as the hissing cockroach or simply hisser, is one of the largest species of cockroach, reaching 2 to 3 inches (5.1–7.6 cm) at maturity. They are from the island of Madagascar off the African mainland, where they can be found in rotting logs. It is one of some 20 known species of large hissing roaches from Madagascar, many of which are kept as pets, and often confused with one another by pet dealers; in particular, G. portentosa is commonly confused with G. oblongonota[1] and G. picea.[2]

Unlike most cockroaches, they are wingless. They are excellent climbers and can scale smooth glass. Males can be distinguished from females by their thicker, hairier antennae and the pronounced "horns" on the pronotum. Females carry the ootheca (egg case) internally, and release the young nymphs only after the eggs have hatched. As in some other wood-inhabiting roaches, the parents and offspring will commonly remain in close physical contact for extended periods of time. In captivity, these insects can live 5 years. They feed primarily on vegetable material.

Hissing[edit]

As the name suggests, the Madagascar hissing cockroach is characterized by its hissing sound, produced when they force air through the respiratory openings (spiracles) found on each segment of their abdomen. The Madagascar hissing cockroach is one member of a group of roaches that can all hiss; this exact mode of sound production is, however, atypical, as most insects that make sound do so by rubbing together various body parts ("stridulation"). Some long-horned beetles, e.g., the giant Fijian long-horned beetle, hiss by squeezing air out from under their elytra, but this does not involve the spiracles. In hissing roaches, the hiss takes three forms: the disturbance hiss, the female-attracting hiss, and the fighting hiss. All cockroaches from the fourth instar (fourth molting cycle) and older are capable of the disturbance hiss. Only males use the female-attracting hiss and fighting hiss; the latter is used when challenged by other males (males will establish a dominance hierarchy, and a submissive male will back down to end a fight).

Associations with other animals[edit]

Hissing cockroach

The mite species Gromphadorholaelaps schaeferi lives on this species of cockroach along the undersides and bases of the legs and takes some of its host's food as well as consuming particulates along the host's body. As these mites do not harm the cockroaches they live upon, they are commensals, not parasites, unless they build up to abnormal levels. Recent studies have shown that these mites also may have beneficial qualities for the cockroaches, in that they clean the surfaces of the cockroaches of pathogenic mold spores, which in turn increases the life expectancy of the cockroaches.

Popular culture[edit]

The Madagascar hissing cockroach has been known to be featured in Hollywood movies, prominently in Bug (1975) as cockroaches who could set fires by rubbing their legs together and, in Damnation Alley (1977), as post-nuclear-war mutant armor-plated "killer" cockroaches. In Starship Troopers, a movie about a war against an enemy called "The Bugs," a teacher is shown encouraging her students to step on this species as part of a TV propaganda broadcast.

A Madagascar hissing cockroach has been used as the driver of a mobile robot.[3] They were used in the reality television series Fear Factor. The species also made an appearance in the movie Men In Black in 1997. This was later parodied in the comedy Team America: World Police (2004), where one emerges from Kim Jong-il's body after his death, enters a tiny spaceship, and flies away.

In September 2006, amusement park Six Flags Great America announced that it would be granting unlimited line-jumping privileges for all rides to anyone who could eat a live Madagascar hissing cockroach as part of a Halloween-themed FrightFest. Furthermore, if a contestant managed to beat the previous world record (eating 36 cockroaches in 1 minute), he would receive season passes for four people during the 2007 season. This is a difficult record to break because raw cockroaches contain a mild neurotoxin that numbs the mouth and makes it difficult to swallow.[citation needed] The promotion ended on October 29, 2006.

As pets[edit]

Hissing roaches kept as pets

Madagascar's cockroaches can be kept as exotic pets. They require a small living area with an area for them to hide because they do not like the light. Due to their propensity to climb, the living area must be tested to see if they can climb it as they do in their natural environment. Fish tanks with screens work best but it is also wise to coat the first few inches with petroleum jelly to keep them from getting out of the habitat that you keep them in. They can live on fresh vegetables along with any kind of pellet food that is high in protein, such as dry dog food.

In the USA, some states require permits before this species can be kept as a pet or in breeding colonies. The state of Florida requires such a permit. In fact, during outreach programs, the University of Florida's Department of Entomology and Nematology, which has such a permit, allows only males to be taken out of the laboratory. This is to prevent the possible introduction of a pregnant female into the environment.

References[edit]

  1. ^ http://www.roachforum.com/index.php?showtopic=3452
  2. ^ Delfosse, E. (2004) Les blattes souffleuses de Madagascar. Insectes 153: 19-22.
  3. ^ "Cockroach Controlled Mobile Robot – Garnet Hertz". Conceptlab.com. Retrieved 2011-04-04. 

External links[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!