Articles on this page are available in 1 other language: Arabic (3) (learn more)

Overview

Brief Summary

The German cockroach (Blattella germanica) is a small species of cockroach, usually about 1.3 cm to 1.6 cm long, tan to light brown in color. The adults are winged, but do not fly. Originally from Africa, it is now the most common and most economically important household pest in the United States. They are common throughout the world, and although they are not cold tolerant they have been found even in the most northerly locations in close association with humans. German cockroaches carry organisms that cause disease, principally bacteria, protozoans, and viruses that cause gut symptoms (food poisoning, dysentery, and diarrhea). They also produce malodorous secretions that taint the flavor of food, and their cast skins are allergens, but they are mostly aethetic pests. Their flat bodies allow them to live in cracks and crevices of human habitations, often in large numbers. German cockroaches scavenge on any food, and even non-food stuffs, such as soap and glue, that are left around, and are commonly found in garbage receptacles. Mostly nocturnal, these insects are very hardy and resilient, and are difficult to exterminate. Females protect their young by holding their eggs in an ootheca until they hatch. Sanitation, keeping garbage containers sealed, putting food away and caulking holes in walls to limit access are helpful for controlling German cockroaches. Chemical baits and dusts also can help.

(Antani and Burgeson 2011; Jacobs 2007; Valles 2008; Wikipedia 2011)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

German cockroaches, believed to have originated in Southeast Asia, are the most widely distributed urban pests. They have been introduced to all parts of the globe including North America, Australia, Africa, and the Oceanic Islands. This ubiquity makes German cockroaches cosmopolitan, with the only deterrent being cold temperatures.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced ); oriental (Native ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

  • 2004. "German Cockroach - Blattella germanica" (On-line). North Carolina Museum of Natural Sciences. Accessed October 18, 2008 at http://naturalsciences.org/microsites/invasives/roach.htm.
  • Jacobs, S. 2007. "German Cockroaches" (On-line). Entomology Notes, Pennsylvania State University. Accessed October 15, 2008 at http://www.ento.psu.edu/extension/factsheets/german_cockroach.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

German cockroaches are ectothermic organisms. Adults measure 12.7 to 15.88 cm in length (average 13.0 cm) and weigh between 0.1 and 0.12 g (average 0.105 g). In general, German cockroaches are monomorphic with a flattened, oval shape, spiny legs, and long antennae. They are sexually dimorphic. Males have a thin and slender body, tapered posterior abdomen, visible terminal segments of the abdomen, and do not have tegmina (leathery outer wings). Females tend to be larger and have a stouter body, rounded posterior abdomen, and tegmina covering the entire abdomen. German cockroaches demonstrate bilateral symmetry at all stages of life.

German cockroaches are light brown in color with two broad, parallel stripes on the dorsal side of the body running lengthwise. Nymphal cockroaches resemble adults in shape; however, they are smaller, darker (dark brown to black), have only a single stripe down the dorsal side, and have undeveloped wings. Egg capsules are light tan and round.

Range mass: 0.1 to 0.120 g.

Average mass: 0.105 g.

Range length: 12.7 to 15.88 cm.

Average length: 13.0 cm.

Sexual Dimorphism: female larger; sexes shaped differently

  • Day, E. August 1996. "German Cockroach." (On-line). Virginia Cooperative Extension, Virginia Polytechnic Institute and State University. Accessed October 14, 2008 at http://www.sites.ext.vt.edu/departments/entomology/factsheets/germanco.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

German cockroaches live in temperate or tropical environments. They prefer warm, humid weather and are solely terrestrial. They inhabit a variety of habitats, from very moist areas, such as rainforests and scrub forests, to somewhat drier areas such as taigas and chaparrals. They are also found in sylvatic areas, such as forests and caves, as well as in urban, suburban, and rural settings. Cold is one of the major factors limiting the habitat of German cockroaches. On average, they are found at elevations of 1200 m, and, due to cold temperatures and dryness, they usually do not reside above 2000 m.

Range elevation: 0 to 2000 m.

Average elevation: 1200 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: taiga ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural ; caves

  • Valles, S. 2008. "German Cockroach" (On-line). University of Florida Institute of Food and Agricultural Sciences – Featured Creatures. Accessed October 10, 2008 at http://entomology.ifas.ufl.edu/creatures/urban/roaches/german.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

German cockroaches often reside in or around human residences due to the accumulation of garbage and detritus. They consume a wide variety of foods, including dead organisms. They usually eat human foods, especially starches, sweets, seeds, grains, grease, and meat products. German cockroaches have also been known to eat soap, toothpaste, and glue.

Animal Foods: carrion ; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Other Foods: detritus

Primary Diet: carnivore (Insectivore , Scavenger ); herbivore (Frugivore , Granivore ); detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

German cockroaches are prey to larger household pests. Because they consume detritus, they aid in the cycling of nutrients. They are also key hosts to parasitic bacteria, protozoans, and viruses, including Blatticola blattae, Hammershmidtiella disingi, Nephridiophaga blattellae, Gregarina blattarum, Lophomonas blattarum, Lophomonas striata, Endolimax blattae, Entamoeba thomsoni, and Nyctotherus ovalis. Some of these parasites utilize humans and other mammals as definitive hosts.

Commensal/Parasitic Species:

  • Tsai, Y., K. Cahill. 1970. Parasites of the German Cockroach (Blattella germanica L.) in New York City. The Journal of Parasitology, 56(2): 375-377. Accessed December 05, 2008 at http://www.jstor.org/pss/3277678.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

German cockroaches are preyed upon by other household pests such as spiders and centipedes as well as domestic pets such as dogs and cats. German cockroaches can re-grow legs when necessary. They prolong their molting cycle to ensure that the new limb grows in during a molt. They also display aposematic coloring in the form of two stripes on their back. German cockroaches are relatively small and are able to hide in small crevices, cracks, and nooks. Nymphs can be as small as 0.7938 mm in width and adults as small as 4.7625 mm. Because of their size and nocturnal habits, they generally do not need to outrun predators.

Known Predators:

Anti-predator Adaptations: aposematic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

German cockroaches use their head ganglia to visually perceive their environment. They can also use their subesophageal ganglia to control thoracic fibers, which, when scraped against their body, produce minute noises. This functions as an alarm signal and allows others to escape predation. German cockroaches also use certain pheromones to signal activities such as feeding and evading predators, although these pheromones are generally used to signal mating.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; vibrations

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

German cockroaches have three developmental stages: egg, nymph, and adult. Females develop 4 to 8 capsules containing 30 to 48 eggs each in their lifetime. Capsules hatch about 28 days after they begins to form. A few weeks thereafter, a new egg capsule begins to form. The egg stage varies in duration from 14 to 35 days. German cockroaches have 6 to 7 nymphal stages occurring over a period of 6 to 31 weeks. They express incomplete metamorphosis: zygotes develop within eggs and hatch directly into nymphs, which then grow into adult cockroaches. The complete life cycle of the cockroach is roughly 100 to 200 days for females, during which 10,000 descendants of a single cockroach can be produced.

Development - Life Cycle: metamorphosis

  • Kunkel, J. 2008. "The Roach FAQ" (On-line). University of Massachusetts – Joe Kunkel’s Web Page. Accessed November 14, 2008 at http://www.bio.umass.edu/biology/kunkel/cockroach_faq.html.
  • McCandless, L. 2005. "CU scientists unravel mating clues of the German cockroach" (On-line). Cornell Chronicle. Accessed November 14, 2008 at http://www.news.cornell.edu/Chronicle/05/2.24.05/cockroach.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Male German cockroaches, on average, live 100 to 150 days. Females live much longer, with an average lifespan of 190 to 200 days.

Range lifespan

Status: wild:
180 to 200 days.

Typical lifespan

Status: wild:
100 to 200 days.

Average lifespan

Status: wild:
140 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating behavior of German cockroaches is driven by pheromones given off by females, which are detected by the antennae of males. German cockroaches breed continuously with many overlapping generations present at any one time. As a result of continuous breeding and promiscuity, population growth has been shown to be exponential.

Mating System: polygynandrous (promiscuous)

German cockroaches are highly active sexually and breed continuously. Rate of breeding slows only during colder months. They breed throughout the year, mate indiscriminately and do not have cycles. They utilize internal fertilization, and females can store sperm for gradual release. When nymphs develop into adults, they become sexually active almost immediately. Females produce 4 to 6 capsules of 30 to 40 eggs each in their lifetime. Consequently, 3 to 4 generations may live together in a colony. Females lay 120 to 240 eggs per session (average 150 eggs), however, they are iteroparous and have multiple layings. Progeny are dioecious and hatch into nymphs in 25 to 30 days (average 28 days). German cockroaches reach independence between 40 and 150 days of age (average 65).

Breeding interval: German cockroaches breed almost continuously.

Breeding season: German cockroaches breed continuously year round, though breeding slows during colder months.

Range number of offspring: 120 to 240.

Average number of offspring: 150.

Range gestation period: 20 to 30 days.

Average gestation period: 28 days.

Range time to independence: 40 to 125 days.

Average time to independence: 65 days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous ; sperm-storing ; delayed fertilization

Females German cockroaches carry their eggs on their back for about 6 weeks before they are laid. They hide their eggs in discrete spots, such as cracks, holes, and dark places. They do not, however, provide parental care after eggs are laid.

Parental Investment: pre-hatching/birth (Protecting: Female)

  • Day, E. August 1996. "German Cockroach." (On-line). Virginia Cooperative Extension, Virginia Polytechnic Institute and State University. Accessed October 14, 2008 at http://www.sites.ext.vt.edu/departments/entomology/factsheets/germanco.html.
  • Jacobs, S. 2007. "German Cockroaches" (On-line). Entomology Notes, Pennsylvania State University. Accessed October 15, 2008 at http://www.ento.psu.edu/extension/factsheets/german_cockroach.htm.
  • Kunkel, J. 2008. "The Roach FAQ" (On-line). University of Massachusetts – Joe Kunkel’s Web Page. Accessed November 14, 2008 at http://www.bio.umass.edu/biology/kunkel/cockroach_faq.html.
  • McCandless, L. 2005. "CU scientists unravel mating clues of the German cockroach" (On-line). Cornell Chronicle. Accessed November 14, 2008 at http://www.news.cornell.edu/Chronicle/05/2.24.05/cockroach.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Feet prevent slipping: insects
 

Feet of insects stick to surfaces using nanometer-thin films of liquid secretions.

   
  "Many insects cling to vertical and inverted surfaces with pads that adhere by nanometre-thin films of liquid secretion. This fluid is an emulsion, consisting of watery droplets in an oily continuous phase. The detailed function of its two-phasic nature has remained unclear. Here we show that the pad emulsion provides a mechanism that prevents insects from slipping on smooth substrates. We discovered that it is possible to manipulate the adhesive secretion in vivo using smooth polyimide substrates that selectively absorb its watery component. While thick layers of polyimide spin-coated onto glass removed all visible hydrophilic droplets, thin coatings left the emulsion in its typical form. Force measurements of stick insect pads sliding on these substrates demonstrated that the reduction of the watery phase resulted in a significant decrease in friction forces. Artificial control pads made of polydimethylsiloxane showed no difference when tested on the same substrates, confirming that the effect is caused by the insects’ fluid-based adhesive system. Our findings suggest that insect adhesive pads use emulsions with non-Newtonian properties, which may have been optimized by natural selection. Emulsions as adhesive secretions combine the benefits of ‘wet’ adhesion and resistance against shear forces." (Dirks et al. 2009)

Watch video

  Learn more about this functional adaptation.
  • Dirks J-H; Clement CJ; Federle W. 2009. Insect tricks: two-phasic foot pad secretion prevents slipping. Journal of the Royal Society Interface.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Blattella germanica

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMH7034-09|EU854321|Blattella germanica| AAACGATGAATATTTTCAACAAATCATAAAGATATTGGAACTCTTTATTTTATCTTCGGAGCTTGATCTGGAATAGTGGGGACATCTTTA---AGAATATTAATCCGAGCAGAGCTAAATCAACCTGGTTCATTAATTGGAGAT---GATCAAATCTATAATGTTATTGTAACGGCTCACGCTTTTGTTATAATTTTCTTTATAGTTATGCCAATTTTAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATA---TTAGGTGCTCCTGATATAGCATTTCCTCGTATAAATAATATAAGTTTTTGACTTTTACCTCCATCTCTATCTCTTCTATTAGCTAGTAGCCTTGTTGAAAGAGGAGCTGGGACTGGTTGAACCGTATACCCTCCCTTAGCTAGAGGAATTGCTCATGCTGGAGCTTCAGTAGATTTA---GCTATTTTCTCATTACATCTTGCAGGTGTCTCATCAATTTTAGGTGCCGTAAATTTTATTTCAACAATTATTAACATGAAACCAATTAATATAAGACCTGAACGAATTCCTTTATTTGTTTGGTCAGTAGGTATTACTGCATTATTATTATTATTATCCTTACCAGTTCTTGCAGGT---GCAATTACAATATTATTAACAGACCGAAATTTAAATACTTCATTTTTTGACCCTGCAGGGGGAGGTGATCCTATTTTATATCAACATTTATTTTGATTCTTTGGACATCCAGAAGTTTATATTTTAATTTTACCAGGGTTTGGTATGATTTCTCATATCATTTGCCATGAAAGAGGTAAAAAG---GAAGCTTTTGGAAATTTAGGAATAATTTTTGCTATATTAGCAATTGGTTTATTAGGATTTGTTGTTTGAGCTCATCATATATTTACTGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Blattella germanica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 14
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

As they are quite abundant, German cockroaches are not considered a species of concern in any part of their range.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Secretions of German cockroaches produce a foul odor when large colonies have amassed. These can also make human foods unpalatable. This can lead to considerable economic loss, especially in parts of the world where food is scarce or expensive. German cockroaches act as hosts to a number of parasites, such as bacteria, protozoans, and viruses, which lead to human ailments. Fouled food and parasites can lead to food poisoning, dysentery, and diarrhea in humans. Bodies, fragments, waste, and secretions of cockroaches are allergens to humans. These can lead to asthma in young children. Also, German cockroaches may bite humans, feed on particles on sleeping humans, and cause psychological stress.

Negative Impacts: injures humans (causes disease in humans , carries human disease); household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive economic effects of German cockroaches on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

German cockroach

Female German Cockroach with ootheca.

The German cockroach (Blattella germanica) is a small species of cockroach, measuring about 1.3 cm (0.51 in) to 1.6 cm (0.63 in) long; however, they are known to get bigger. It can be tan through brown to almost black, and has two dark parallel streaks running from the head to the base of the wings. Although it has wings, it is unable to sustain flight. Found throughout many human settlements. These insects are particularly associated with restaurants, food processing facilities, hotels, and nursing homes. In colder climates, they are found only near human habitats, since they are not very tolerant to cold. However German cockroaches have been found as far north as Alert, Nunavut,[1] and as far south as southern Patagonia[2]. The German cockroach is originally from Africa. It is very closely related to the Asian cockroach, and to the casual observer they appear nearly identical and may be mistaken for the other. This cockroach can be seen in the day occasionally, especially if there is a large population or if they have been disturbed. However, sightings are most commonly reported in the evening hours as they are most active at night. This type of cockroach can emit an unpleasant odor when excited or frightened.

Contents

Pest control

The German cockroach (also known as a "hood" in the U.S.) is very successful at establishing an ecological niche in buildings, and is very hardy and resilient against attempts at pest control. This is because of the large number of nymphs produced from each egg case, the short period between birth and sexual maturity, and their ability to easily hide due to their small size. The mother also carries the egg case (called an ootheca) with her during the germination period, rather than depositing it like other species, a practice which would leave them vulnerable in a human habitat to zealous attempts to wipe them out. This cockroach is also smaller than many other species so it can more easily hide and fit into very small cracks and crevices to evade humans. That is also the main reason they can most effectively be controlled with bait in cracks and crevices near harborages.[3] These type of pest control methods must kill 95% of the overall population to be effective in a property due to the fast reproductive cycles.[4] The German cockroach, discounting the presence of pets, has few natural predators inside a human habitat. The German cockroach's thigmotactic nature compounds the difficulty of pest control treatment. The immature cockroaches will live off excretions and moults from the adult cockroaches and thus can remain hidden away from most surface treatments.[5]

Diet

The German cockroach is omnivorous and a scavenger. They particularly like starch, sugary foods, grease and meats. In certain situations where there is a shortage of foodstuffs, they may eat household items such as soap, glue and toothpaste or they may even turn cannibalistic, often chewing on the wings and legs of each other.

Comparison of three common cockroaches

CockroachGerman cockroachOriental cockroachAmerican cockroach
Size12 mm (1.2 cm) to 15 mm (1.5 cm)25 mm (2.5 cm) to 30 mm (3.0 cm)28 mm (2.8 cm) to 43 mm (4.3 cm)
HabitatHeated buildings, optimum 32 °C (90 °F)20 °C (68 °F) to 29 °C (84 °F)Same as German
Nymphal development time6 to 12 weeks6 to 12 months4 to 15 months
Life Span6 to 9 months1 to 1.5 years1 to 1.5 years
Able to fly?NoNoYes

See also

References

  1. ^ The insects and arachnids of Canada, part 14, The Grasshoppers, Crickets, and related insects of Canada and adjacent region
  2. ^ Faúndez, E. I. & M. A. Carvajal. 2011. Blattella germanica (Linnaeus, 1767) (Insecta: Blattaria) en la Región de Magallanes. Boletín de Biodiversidad de Chile, 5: 50-55.
  3. ^ Amalgamated Pest Control
  4. ^ Rose Pest Control
  5. ^ Federal Pest Control
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!