Molecular Biology and Genetics

Molecular Biology

Barcode data: Halgerda batangas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGACTCCTAGGAACAGGGCTTAGCTTATTAATTCGATTTGAATTAGGAACAGCGGGTGCTTTTCTTGGTGAT---GACCATTTTTATAATGTAATTGTTACTGCGCATGCTTTCGTAATAATTTTCTTTATGGTAATACCGCTGATAATTGGAGGTTTTGGAAACTGAATGGTACCATTACTAATTGGAGCACCAGACATAAGATTTCCCCGTATAAATAACATAAGTTTCTGATTACTGCCACCATCTTTTATCCTCTTACTATGTTCAACTTTAATAGAAGGAGGAGCCGGAACAGGATGAACTGTCTATCCACCATTATCCGGACCAGTCGCTCATGGAGGTACCTCTGTAGATCTAGCTATTTTTTCTTTACACCTAGCAGGAGCTTCCTCACTACTTGGTGCAATTAATTTTATTACTACAATTTTCAATATACGATCCTCAGCTATATCCATAGAACGAGTGAGGTTGTTTGTCTGATCAGTATTAGTGACAGCCTTCTTACTTCTTCTTTCTCTCCCGGTTCTTGCAGGAGCAATTACTATACTATTAACTGATCGAAATTTTAACACTAGATTTTTTGATCCAGCAGGGGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halgerda batangas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Halgerda batangas

Halgerda batangas is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Discodorididae.[2]

Contents

Distribution

This species is found in the tropical western Pacific, including: Indonesia, Philippines, Solomon Islands, Mabul, New Britain, the Davao Gulf, Malaysia, Papua New Guinea, Sulawesi, Great Barrier Reef and Taiwan.[3][4]

Description

This animal is one of a group of mainly white species of Halgerda with orange markings. It is characterized by a network of fine, solid, red-orange lines on the mantle. It has a white band around the mantle containing low rounded orange-capped tubercles. The mantle tubercles range in size from small rounded bumps to tall, prominent structures.[3]

References

  1. ^ Erwin Koehler, Darmstadt, Germany. "Halgerda batangas Carlson & Hoff, 2000". Medslugs.de. http://www.medslugs.de/E/taxonomy/Halgerda_batangas.htm. Retrieved 2010-10-28.
  2. ^ Bouchet P. & Rocroi J.-P. (Ed.); Frýda J., Hausdorf B., Ponder W., Valdes A. & Warén A. 2005. Classification and nomenclator of gastropod families. Malacologia: International Journal of Malacology, 47(1-2). ConchBooks: Hackenheim, Germany. ISBN 3-925919-72-4. ISSN 0076-2997. 397 pp. http://www.vliz.be/Vmdcdata/imis2/ref.php?refid=78278
  3. ^ a b Rudman, W.B.. "Halgerda batangas". The Sea Slug Forum. http://www.seaslugforum.net/factsheet.cfm?base=halgbata. Retrieved 2010-10-28.
  4. ^ "Halgerda batangas Carlson & Hoff, 2000 - Discodorididae". Nudi Pixel. http://www.nudipixel.net/species/halgerda_batangas/. Retrieved 2010-10-28.

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!