Molecular Biology and Genetics

Molecular Biology

Barcode data: Halgerda batangas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGACTCCTAGGAACAGGGCTTAGCTTATTAATTCGATTTGAATTAGGAACAGCGGGTGCTTTTCTTGGTGAT---GACCATTTTTATAATGTAATTGTTACTGCGCATGCTTTCGTAATAATTTTCTTTATGGTAATACCGCTGATAATTGGAGGTTTTGGAAACTGAATGGTACCATTACTAATTGGAGCACCAGACATAAGATTTCCCCGTATAAATAACATAAGTTTCTGATTACTGCCACCATCTTTTATCCTCTTACTATGTTCAACTTTAATAGAAGGAGGAGCCGGAACAGGATGAACTGTCTATCCACCATTATCCGGACCAGTCGCTCATGGAGGTACCTCTGTAGATCTAGCTATTTTTTCTTTACACCTAGCAGGAGCTTCCTCACTACTTGGTGCAATTAATTTTATTACTACAATTTTCAATATACGATCCTCAGCTATATCCATAGAACGAGTGAGGTTGTTTGTCTGATCAGTATTAGTGACAGCCTTCTTACTTCTTCTTTCTCTCCCGGTTCTTGCAGGAGCAATTACTATACTATTAACTGATCGAAATTTTAACACTAGATTTTTTGATCCAGCAGGGGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halgerda batangas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Halgerda batangas

Halgerda batangas is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Discodorididae.[2][3]

Distribution[edit]

This species was described from the Philippines, with a holotype specimen measuring 40 mm in length, alive, from Mactan Island, Cebu and a paratype measuring 35 mm from Anilao, Batangas. It is found in the tropical western Pacific, including: Indonesia, Philippines, Solomon Islands, Mabul, New Britain, the Davao Gulf, Malaysia, Papua New Guinea, Sulawesi, Great Barrier Reef and Taiwan.[4][5]

Description[edit]

This animal is one of a group of mainly white species of Halgerda with orange markings. It is characterized by a network of fine, solid, red-orange lines on the mantle. It has a white band around the mantle containing low rounded orange-capped tubercles. The mantle tubercles range in size from small rounded bumps to tall, prominent structures.[4][6]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!