Ecology

Associations

Foodplant / collects
adult of Colletes hederae collects pollen of Hedera helix

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colletes hederae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATTTTTGCTATGTGAACTGGAATAATTGGMTCATCTTTAAGAATAATTATTCGTATAGAATTAAGATCTCCAGGTATATGAATTAATAAT---GATCANATTTATAATTCTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTTTTTTAATTGGTGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATAGCATTTGCTCGTATAAATAATATAAGATTTTGATTATTACCTCCTTCATTATTTTTATTATTAATAAGAAGAATTTTATATTCAGGTAGAGGAACTGGATGGACTATTTATCCTCCTTTATCTTCATTAATATATCATCCTTCATTATCTGTTGATTTAACAATTTTTTCTTTACATATTGCAGGTATTTCATCAATTATAAGATCTATAAATTTTATTGTAACAATTTTAAATATAAAAAATTATAATTTAAATTATGATCAATTATCTTTATTTTCTTGATCTGTTTTTATTACAACAATTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACTTCTTTTTTTGATCCTTCTGGAGGTGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Colletes hederae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Colletes hederae

Colletes hederae, the Ivy Bee, is a species of plasterer bee belonging to the family Colletidae subfamily Colletinae.

These mining bees are known from Austria, Belgium, Channel Islands, Croatia, Cyprus, southern England, France, Germany, Greece, Italy, Luxembourg, Netherlands, Serbia, Slovenia, Spain and Switzerland.[1][2]

C. hederae – male, lateral view

They have been only recently described (Schmidt & Westrich 1993) as a distinct species. Until then, they were confused with another species of Colletes the morphologically very similar Colletes halophilus.

The thorax of the adults is covered by orange-brown hair, while each abdominal segment has an apical orangey hair-band. The females are on average 13 millimetres (0.51 in) long, while the males are about 10 mm (0.39 in) long.

The adults emerge late in the year (the males from late August and the females a little later in early September) and remain on the wing until early November. The principal pollen forage plant is Ivy (Hedera helix)(hence the specific epithet hederae), but both sexes will also nectar at Ivy flowers too. When Ivy is scarce, other species of plants are also visited. The females supply the larval brood almost cells exclusively with nectar and pollen of ivy flowers. When Ivy flowering is delayed, females may also collect pollen at various members of the Daisy family (Asteraceae).

These are solitary bees, and do not live in colonies and do not overwinter as adults. They nest in clay-sandy soils, especially in loess hills and soft-rock cliffs. Like many other solitary bees, they can often be found nesting in dense aggregations, sometimes numbering many tens of thousands of nests. In parts of the west European range of the species, Colletes hederae are fequently parasitized by the larvae of the meloid beetle Stenoria analis, that feed on the supply of nectar and pollen prepared by females bees in their nests.

References

Bibliography

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!