Overview

Distribution

Range Description

Colletes hederae has been recorded from Cyprus and many parts of southern and western Europe where it is currently rapidly extending its range northwards (Ortiz-Sánchez et al. 2002; Bischoff et al. 2005; Kuhlmann et al. 2007, 2012; Roberts et al. 2011). The extent of occurrence (EOO) in Europe is 3,271,208 km² and in the EU 27 is 3,180,515 km². The area of occupancy (AOO) in Europe is 1,200 km² and in the EU 27 is 1,120 km².
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Colletes hederae occurs in a wide range of open habitats including anthropogenic habitats like gardens or sand pits. The species is a flower visitor that preferably collects pollen on Hedera (Araliaceae) (it is polylectic, taking pollen from a wide variety of plants, but with strong preference for Hedera) (Müller and Kuhlmann 2008, Westrich 2008).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Foodplant / collects
adult of Colletes hederae collects pollen of Hedera helix

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colletes hederae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATTTTTGCTATGTGAACTGGAATAATTGGMTCATCTTTAAGAATAATTATTCGTATAGAATTAAGATCTCCAGGTATATGAATTAATAAT---GATCANATTTATAATTCTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTTTTTTAATTGGTGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATAGCATTTGCTCGTATAAATAATATAAGATTTTGATTATTACCTCCTTCATTATTTTTATTATTAATAAGAAGAATTTTATATTCAGGTAGAGGAACTGGATGGACTATTTATCCTCCTTTATCTTCATTAATATATCATCCTTCATTATCTGTTGATTTAACAATTTTTTCTTTACATATTGCAGGTATTTCATCAATTATAAGATCTATAAATTTTATTGTAACAATTTTAAATATAAAAAATTATAATTTAAATTATGATCAATTATCTTTATTTTCTTGATCTGTTTTTATTACAACAATTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACTTCTTTTTTTGATCCTTCTGGAGGTGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colletes hederae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Kuhlmann, M.

Reviewer/s
Miller, R.M., Nieto, A. & Roberts, S.

Contributor/s

Justification
Global and European regional assessment: Least Concern (LC)
EU 27 regional assessment: Least Concern (LC)

Listed as Least Concern because this species can be locally very common and it is spreading its range into western and central Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
At least in western and central Europe populations are often very large and the species is rapidly extending its range northwards and westwards (Ortiz-Sánchez et al. 2002; Bischoff et al. 2005, Kuhlmann et al. 2007, 2012; Roberts et al. 2011).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species occupies anthropogenic habitats and is expanding its range, thus, is tolerant of habitat degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

This species is included in the National Red List or Red Data Book of Slovenia (Endangered; Anonymous 2002).

It is recommended to conserve suitable habitats (e.g., open vegetation types with bare soil), nesting sites and the host plants of this species.

Further research is required to establish the current status of the species throughout its range and to identify the existing threats.

The species occurs in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colletes hederae

Colletes hederae, the Ivy Bee, is a species of plasterer bee belonging to the family Colletidae subfamily Colletinae.

These mining bees are known from Austria, Belgium, Channel Islands, Croatia, Cyprus, southern England, France, Germany, Greece, Italy, Luxembourg, Netherlands, Serbia, Slovenia, Spain and Switzerland.[1][2]

C. hederae – male, lateral view

They have been only recently described (Schmidt & Westrich 1993) as a distinct species. Until then, they were confused with another species of Colletes the morphologically very similar Colletes halophilus.

The thorax of the adults is covered by orange-brown hair, while each abdominal segment has an apical orangey hair-band. The females are on average 13 millimetres (0.51 in) long, while the males are about 10 mm (0.39 in) long.

The adults emerge late in the year (the males from late August and the females a little later in early September) and remain on the wing until early November. The principal pollen forage plant is Ivy (Hedera helix) (hence the specific epithet hederae), but both sexes will also nectar at Ivy flowers too. When Ivy is scarce, other species of plants are also visited. The females supply the larval brood almost cells exclusively with nectar and pollen of ivy flowers. When Ivy flowering is delayed, females may also collect pollen at various members of the Daisy family (Asteraceae).

These are solitary bees and do not live in colonies and do not overwinter as adults. They nest in clay-sandy soils, especially in loess hills and soft-rock cliffs. Like many other solitary bees, they can often be found nesting in dense aggregations, sometimes numbering many tens of thousands of nests. In parts of the west European range of the species, Colletes hederae are fequently parasitized by the larvae of the meloid beetle Stenoria analis, that feed on the supply of nectar and pollen prepared by females bees in their nests.

References[edit]

  1. ^ "Fauna Europaea : Colletes hederaes". Retrieved 2012-11-06. 
  2. ^ "BWARS Information Sheet". Retrieved 2012-11-06. 

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!