Overview

Brief Summary

The Rusty-patched Bumblebee (Bombus affinis) was at one time among the more common and widespread bumblebees in eastern North America. However, this is no longer the case. The first decade of the 21st century saw growing concern about declining pollinator populations in general in several regions of the world, with particular attention focused on bees, and much of the available data on declining bee populations has focused on bumblebees. Although populations of some bumblebee species appear to be robust, many others have apparently gone extinct in recent years or suffered dramatic declines. Bombus affinis is one of several North American bumblebee species that have experienced clear declines. Colla and Packer (2008) documented an impoverishment of the bumblebee community in general in southern Ontario (Canada) between the early 1970s and the first decade of the 21st century and found that B. affinis, in particular, declined dramatically in abundance not only in southern Ontario but throughout its native range. There is evidence of declines in three other North American bumblebees as well (all four belong to the subgenus Bombus): B. franklini and B. occidentalis in the west and B. terricola in the east. Bombus franklini, which had a historically small geographic distribution, is thought to be at the brink of extinction (or possibly extinct). Bombus affinis, B. terricola, and B. occidentalis have much larger historical ranges, but have disappeared from numerous sites where they were previously common. (Colla and Packer 2008 and references therein)

The Xerces Society, an organization dedicated to invertebrate conservation, is an excellent resource for more information about Bombus affinis and about broader bumblebee conservation issues.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The rusty patched bumble bee (Bombus affinis) is named after the small rust-colored patch visible on worker bees' abdomens. Worker bees also have yellow on the first and rear half of the second abdominal segment. The remaining abdominal segments are black. Queens and males resemble workers except that they lack the rust-colored patch. Queens are larger in size than workers and have a small central bare patch on the thorax.

This bee was historically found throughout the eastern and upper midwestern United States. However, surveys between 2003 and the present have found only a small number of this species in Illinois and Wisconsin.

  • Bumble bees: rusty-patched bumble bee (Bombus affinis) (Xerces Society)
  • Pocket Guide to Identifying the Rusty Patched Bumble Bee Bombus affinis (Xerces Society)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) The historic range was at least from central Maine across southernmost parts of Quebec and Ontario to most of Minnesota and a small part of the Dakotas extending south to New Jersey, and mostly (but not entirely) in the mountains into Georgia eastward, but only to northern Illinois westward (Evans et al., 2008; Colla and Packer, 2008). There reportedly was also a collection near St. Louis, Missouri in the 1990s (Michael Arduser pers. comm. to D. Schweitzer, September 2008) but that should clearly be treated as historic now. This bumblebee was not documented from the coastal plain south of New Jersey. In Quebec, this species has been confirmed from Gatineau and Montréal (COSEWIC 2010).

There is little basis for defining any current range, and Colla and Packer (2008) found the species at only one site in Ontario in 2004-2006, during efforts through much of the historic range. Since 2003 records have been from extreme southern Ontario to the Indianapolis area, northern Illinois and Wisconsin with records in Ontario (S. Colla) and Indiana (E. Day) in 2009 according to Leif Richardson. The Xerces Society website (http://www.xerces.org/rusty-patched-bumble-bee/) as of December (2008) indicates that there has been a record in Wisconsin and a few in Illinois since 2003, but some of these occurrences could easily have died out since. Sarina Jepsen of the Xerces Society (email to Nicole Capuano, September 2009) reports records near Peoria and Rockford, Illinois in 2009 (also see Berenbaum et al., 2010). Other recent records compiled by Evans et. al. (2008) one in Maryland in 2002 but no more in 2003-2007(sample size >1000). In Indiana they report B. affinis was 12% of a 2001 sample, 0.004% in 2002 and none in 2003, and no records for that state are known since then. Similarly in Iowa the last collections were in 2000 and 2001. One turned up in northern Illinois in 2003-2004 and in Wisconsin in 2006. More recent efforts in Illinois found the species locally common at one site in McHenry County in 2007 and singletons were collected in three other counties that year and one individual in 2008. Surveys in Virginia in 2002-2005 and western North Carolina 2002-2007 found none, and it had been regular through 2001 at the North Carolina site. The last record in Great Smoky Mountains National Park was in 1997, and a 2002 bee survey produced none. Richardson (2008) noted only the Ontario population has "known extant" but there would appear to have still been at least one or two in Illinois at that time, and it is not clear that the Ontario one still is. There is no basis to determine any plausible current range extent. Considering the rapidity of decline since 2002, for this subgenus records before 2006 probably should be considered historic, but nevertheless this species seems to be turning up repeatedly, but not commonly, from 2003 to 2009 in a limited area of Illinois, Wisconsin, Minnesota and Ontario, which suggests a core area, perhaps two areas, of persistence. It is probably localized even within this core area. The Xerces Society has records for 2012 from several places each in Illinois (including another for the Rockford area), Minnesota, and especially Dane County Wisconsin, and others from those states in 2010 and 2011. There was also one from Cape Cod, Massachusetts in 2009, and one near Philadelphia in 2007. The Xerces Society has records for 2012 from several places each in Illinois (including another for the Rockford area), Minnesota, and especially Dane County Wisconsin, and others from those states in 2010 and 2011. There were also isolated records from Cape Cod, Massachusetts in 2009 and near Philadelphia in 2007.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The historical range of Bombus affinis extends from southern Ontario and southwestern Quebec (but apparently not New Brunswick, contrary to apparently erroneous literature references) in Canada south to Georgia and west to the Dakotas in the United States, with occurrences in the southern portion of the range limited mainly to higher elevations (Thorp and Shepherd 2005; Colla 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Bombus affinis queens and workers differ slightly in coloration (an uncommon feature in bumble bees). Other than size, the primary difference between queens and workers is the presence of a medial rusty patch on the second abdominal segment of the worker. The hairs of workers are entirely black on the head, the bottom of the thorax, and in large part on the legs. The rest of the thorax has mostly yellow hair, with a black area in the middle of the thorax. Hairs are entirely yellow on the first two abdominal segments and black on the rest of the abdomen. On workers, there is more black intermixed with yellow near the base of the wings, forming something of a band between the wings, and black hairs extend posteriorly in a narrow "V" that partially bisects the yellow on the scutellum. The second abdominal segment has a rusty reddish patch centrally, with yellow hairs around the edges of the segment. Bombus affinis males have hairs largely black on the head, but with a few pale hairs intermixed near the top of the head. Black hairs sometimes form an obscure band across the middle of the thorax, but the hair on the thorax is otherwise largely pale yellowish. The first two abdominal segments have pale yellow hair. The hair on the rest of the abdominal segments is black. (Evans et al. 2008)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Lectotype for Bombus affinis Cresson, 1863
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male; Worker;
Preparation: Pinned
Locality: Canada, Unknown
  • Lectotype: 1863. Proceedings of the Entomological Society of America. 2: 103.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Bombus affinis has been collected in a wide variety of habitats including mixed farmland, sand dunes, marshes, and both urban and wooded areas (Colla 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Macfarlane (1974, cited in Colla and Packer 2008) observed B. affinis visiting at least 65 plant genera. These bees have been observed biting holes (i.e. nectar-robbing) in flowers with long corolla tubes such as Jewelweed (Impatiens capensis), Yellow Toadflax (Linaria vulgaris) (R. Gegear pers. comm., cited in Colla and Packer 2008), and Cow Vetch (Vicia cracca) (Harder 1983, cited in Colla and Packer 2008).

Bombus affinis is one of two host species for the socially parasitic Bombus (Psithyrus) ashtoni (the other host being the also declining B. terricola) (Fisher 1983). In 2010, Colla reported that B. ashtoni had not been observed in a decade. Bombus species in the subgenus Psithyrus lack pollen-collecting corbiculae and rely on the host workers for the rearing of reproductives. Sladen (1912, cited in Fisher 1983a) reported that the host queen was always killed or displaced by the invading Psithyrus, while Plath (1934, cited in Fisher 1983a) found that in the case of the two North American Psithyrus species he studied (B. ashtoni and B. citrinus) the queen was seldom killed. Subsequent investigations showed that B. ashtoni never kills queens of either of its host species, B. affinis and B. terricola (Fisher 1983a). Fisher found that B. ashtoni is incapable itself of suppressing ovarian development in queenless workers of B. affinis. An alternative strategy to physiological suppression of oogenesis is behavioral domination. Fisher reported that B. ashtoni females were often seen mauling workers, i.e., grasping and pulling them underneath the body as if to sting, but not actually doing so. This behavior only occurred in colonies which had no queen or had a queen that had lost her dominance (ovarian development of workers is normally supressed by the queen). Physical dominance by B. ashtoni females would not prevent oogenesis, but could eliminate or minimize egg laying by fecund workers. Fisher presented data suggesting that females of B. ashtoni benefit by the supression of host worker reproduction by the host queen. At the same time, B. ashtoni females prevent Bombus affinis males and queens from developing by selectively eating eggs and ejecting larvae. The non-aggressive invasion strategy used by B. ashtoni is quite distinct from that of other Psithyrus species, such as B. citrinus, which according to Fisher always kills or displaces its B. impatiens host queen. These other species presumably possess themselves the physiological or behavioral means of eliminating or reducing the frequency of egg laying by host workers in the nests they invade and thus do not need to rely on the host queen to control the workers. (Fisher 1983a) Fisher (1983b) investigated host nest finding by B. ashtoni. These bees search for nests within one to two weeks of host queen emergence at a time prior to emergence of the first worker brood and therefore cannot use odor trails of workers to recognize nests. In laboratory experiments, Fisher showed that B. ashtoni females can recognize host nest odor without actual contact with the nest or with worker-laid trails, successfully distinguishing nests of B. affinis and B. terricola from those of B. bimaculatus and from controls consisting only nest material.

Martin et al. (2010) investigated the cuticular hydrocarbon cues of 14 European Bombus species, including 5 socially parasitic species ("cuckoo bees" in the subgenus Psithyrus) (B. affinis, B. ashtoni, or any other North American species, were not among the species studied, but the general conclusions of the analysis by Martin et al. likely apply more broadly). They found that found that bumblebees possess species-specific alkene positional isomer profiles that are stable over large geographic regions and are mimicked by three host-specific Psithyrus parasites. In three host-cuckoo associations where mimicry is poor, possibly as a result of recent host shifts, these cuckoos produce dodecyl acetate a known chemical repellent that allows the cuckoos to invade their host colonies. Thus, various Psithyrus species may use both mimicry and repellents to invade host colonies.

Microscopic endoparasites recorded infecting B. affinis include Sphaeruluria bombi (a nematode infecting 10% of overwintered queens) and the apicomplexan protozoan Apicystis bombi (Neogregarinida: Ophrocystidae) (Macfarlane et al. 1995, cited in Colla 2010). Other parasites that are known to infect sympatric Bombus species are Nosema bombi (Microsporidia: Nosematidae) and the trypanosome protozoan Crithidia bombi (Kinetoplastea: Trypanosomatidae), both of which may be acquired at flowers via fecal transmission (Colla et al. 2006). Nosema bombi has recently been found infecting B. affinis (Cameron et al. 2011), but infection of B. affinis by C. bombi has apparently not yet been documented (possibly because of the relative recency of the presumed introduction of this parasite from Europe in combinatuon with the rarity of B. affinis in recent years) (Colla 2010). Several species of parasitoid conopid flies (Diptera: Conopidae) attack foraging bumblebees on the wing and lay their eggs inside the bee’s abdomen. (Gillespie 2010 and references therein)

Conopids and C. bombi can affect colony reproduction and worker foraging behavior. Nosema bombi may reduce colony fitness and worker survival. These parasites could affect local abundance of bumblebee populations and C. bombi and N. bombi have been tentatively implicated in the overall decline of bumblebees. In a study in Massachusetts, Gillespie (2010) found a high level of parasitism of bumblebees by C. bombi, N. bombi, and conopid flies (although no B. affinis were encountered in this study). (Gillespie 2010 and references therein)

Bombus affinis has been shown to be an excellent pollinator of cranberry and also to pollinate other important crops such as plum, apple, alfalfa, and onion for seed production. Evans et al. provide a long list of wild plants known to be visited by B. affinis. (Evans et al. 2008 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Flowering Plants Visited by Bombus affinis in Illinois

Bombus affinis Cresson: Apidae (Bombini), Hymenoptera
(observations are from Reed, Graenicher, Betz et al., Williams, Arnold, Clinebell, Schoen, Ne'eman et al., Larson & Barrett, Macior, Conger, Lindsey, Cane et al., Reader, Cane & Schiffhauser, and Costelloe)

Apiaceae: Thaspium barbinode (Lnd); Asclepiadaceae: Asclepias hirtella [plup sn] (Btz), Asclepias meadii [plup sn] (Btz); Asteraceae: Arctium lappa sn cp (Gr), Aster drummondii sn cp (Gr), Aster lanceolatus (Re), Aster ontarionis (Re), Aster oolentangiensis (Re), Aster puniceus sn cp (Gr), Aster sericeus (Re), Cirsium altissimum sn (Gr), Crepis tectorum (Re), Echinacea purpurea (Cl), Eupatoriadelphus purpureus sn (Gr), Eupatorium perfoliatum sn cp (Gr), Helianthus giganteus sn cp (Gr), Liatris pycnostachya (Cl), Oligoneuron rigidum (Re), Solidago canadensis sn cp (Gr, Re), Solidago nemoralis (Re), Solidago speciosa (Re); Boraginaceae: Onosmodium molle (Wm); Campanulaceae: Lobelia siphilitica fq (Mc); Caprifoliaceae: Diervilla lonicera (Sch); Ericaceae: Andromeda glaucophylla (Rd), Chamaedaphne calyculata (Rd), Vaccinium macrocarpon sn (CS), Vaccinium stamineum (Cn); Fabaceae: Amorpha canescens (Re), Dalea purpurea (Re), Dalea villosa (Re), Melilotus alba (Re); Fumariaceae: Dicentra cucullaria sn prf sn@prf fq (Mc); Grossulariaceae: Ribes hirtellum sn (Gr); Lamiaceae: Agastache foeniculum (Re), Monarda fistulosa (Re), Nepeta cataria (Re), Pycnanthemum virginianum (Re), Stachys aspera sn/cp (Cng), Teucrium canadense sn/cp (Cng); Melastomataceae: Rhexia virginica cp (LBt); Parnassiaceae: Parnassia glauca sn (Gr); Primulaceae: Dodecatheon meadia cp (Mc); Ranunculaceae: Aquilegia canadensis sn prf sn@prf (Mc), Delphinium tricorne prf sn@prf fq np (Mc); Sarraceniaceae: Sarracenia purpurea cp (NNE); Scrophulariaceae: Linaria vulgaris fq (Arn, Mc), Pedicularis canadensis sn (Mc), Pedicularis lanceolata cp (Mc, Cst), Penstemon grandiflorus (Re); Solanaceae: Solanum dulcamara cp (Mc); Verbenaceae: Verbena stricta (Re)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 300

Comments: About 10-15 years ago there were probably at least thousands of occurrences with millions of hives, now by far most are gone. A recent survey from Ontario to Georgia in 2004-2006 (Colla and Packer, 2008) produced one specimen in Ontario. Except that there has been a huge decline in abundance and probably range in recent decades, nothing else can be stated with any confidence about a current range. The species has become undetectable and may be extirpated from most of its range. There is no basis to suggest the current number of occurrences. Since 2005 about half a dozen occurrences have been documented, but some, especially the Maryland one, probably have died out.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

The flight season of Bombus affinis is longer than that of most other North American bumblebees and it visits numerous plant genera in diverse habitats (Colla 2010).

Bombus affinis have relatively short tongues. On average, the tongues of workers are around 5 to 7 mm in length (some other bumblebee species have tongues as long as 10 mm). Their short tongues make them unable to access the nectar in flowers with deep tubes, although they sometimes use their mandibles to chew holes in the bottom of these flowers to access the nectar from the outside of the flower, thus cheating the flower of pollination. (Evans et al. 2008 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Bombus affinis typically nests underground in abandoned rodent burrows located from six to eighteen inches below the surface. Occasionally nests are constructed on the surface in areas such as clumps of grass on the ground. Thus, nesting sites may be limited by the abundance of rodents and the presence of undisturbed grassland. (Evans et al. 2008 and references therein).

Brood cells and honey pots are made of wax produced by the queen and workers. Like other bumblebees, B. affinis have an annual life cycle (i.e., 1 year = 1 generation). Mated queens emerge from diapause in the spring to begin feeding and searching for potential nest sites to initiate new colonies. The queen collects nectar and pollen from flowers to support the production of her eggs (which are fertilized by sperm she has stored since mating the previous fall) and produces a brood of workers. In the early stages of colony development, the queen is responsible for all food collection and care of the young. As the colony grows, workers take over the duties of food collection, colony defense, and care of the young. The queen then remains within the nest and spends most of her time laying eggs. As the summer progresses, the colony reaches maximum worker production and begins producing males and potential queens (queen production is dependent on access to sufficient quantities of pollen). These reproductive individuals leave the colony and mate. After mating, young queens enter diapause and overwinter. The males and workers decline as fall approaches until they die in the winter. (Evans et al. 2008; Colla 2010).

The largest B. affinis colony on record produced 2,100 individuals in captivity (MacFarlane 1974, cited in Colla 2010), but in the wild colonies are much smaller (Colla 2010). More typically, B. affinis colonies consist of a queen and between 50 and 400 workers at their peak (Evans et al. 2008).

Bombus affinis is a "pollen-storer", meaning the larvae live in cells and are fed individually by adults opening the brood clump as the larvae develop. Pollen-storing adults emerge relatively equal in size compared to "pocket-making" bumble bee species, which tend to produce workers that vary greatly in size due to unequal food distribution within the brood clumps during development. (Colla 2010)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

Bombus affinis was first described by Cresson in 1863. Although the taxonomy of some bumble bee species is controversial, the status of B. affinis as a distinct, valid species is not (Cameron et al. 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Because of the particular haplodiploid mode of sex determination characteristic of bees, which normally yields diploid females and haploid males but results in the production of non-viable diploid males when allelic diversity is low (and hence homozygosity is high), effective population size relative to census size is much reduced and bee populations in general may therefore be especially vulnerable to extinction as population size shrinks (Zayed and Packer 2005).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Bombus affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATAATATATTTTATTTTTGCTATATGATCAGGAATAATTGGTTCATCAATAAGTTTATTAGTTCGAATAGAATTAAGTCATCCAGGAATATGAATTAATAATGATCAAATTTATAATTCTTTAGTAACTAGACATGCATTTTTAATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTTGGTAATTACTTAATTCCATTAATATTAGGATCACCAGATATAGCTTTTCCTCGAATAAATAATATTAGATTTTGACTATTACCCCCATCATTATTTATATTATTATTAAGAAATTTATTTACACCTAATGTAGGAACAGGATGAACTATTTATCCCCCTTTATCTTCTTATTTATTTCATTCTTCACCATCAATTGATATTGCAATCTTCTCATTGCATATATCAGGAATTTCTTCTATTATTGGATCATTAAATTTTATTGTAACTATTTTATTAATAAAAAATTTTTCATTAAATTATGATCAAATTAATTTATTCTCATGATCAGTATGTATTACTGTAATTTTATTAATTTTATCTCTACCAGTATTAGCTGGAGCAATTACAATATTACTTTTTGATCGAAATTTTAATACCTCATTTTTTGACCCTATAGGAGGAGGAGACCCAATTTTATATCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bombus affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1 - Critically Imperiled

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: This was a very widespread bumblebee in eastern and central North America, but like three others of its subgenus it has suffered a severe to catastrophic decline starting in or just after the late 1990s. Williams et al. (2008) assign it the highest decline measure of any Canadian Bombus, also higher than any Chinese species, but lower than most British species. Williams and Osbourne (2009) conclude the species merits critically endangered by IUCN standards. While there are no actual historic population data, the decline in numbers and area of occupancy has almost certainly been over 99% and reduction in range extent apparently around 90% over a period of less than a decade. B. affinis may be well on the way to extinction, perhaps within the current decade, but other outcomes are also still possible. Historical collection records and the literature indicate that Bombus affinis was still a common bumblebee in the mid or even late 1990s. It is also noteworthy that while the closely related B. terricola is still persisting fairly widely in Vermont, B. affinis has not turned up in recent efforts there. Whether there will prove to be a few long-term refugia in the core range in the upper Midwest is unknown. Other known current refugia for this subgenus (e.g. Koch, 1911) are mostly far to the north or west of the range of B. (B.) affinis. See also account for B. (B.) occidentalis in this database.

If in fact pathogen spillover is the main cause, very widespread extirpations or even extinction of this and one or two other species of subgenus Bombus are likely. On the other hand the species is persisting, although apparently in low numbers, in a limited core area near the middle of its range, and there could be scattered undetected refugia and possibly some resistance could evolve as in related European species, and perhaps some far northern populations of this subgenus (but not this species) in North America (see Koch, 2011). There is no conservation status rank that really captures this sort of extreme decline of recently common and widespread species and several important ranking factors are unknown. GU would be a very reasonable rank. Otherwise, the least misleading rank would be G1, or a combination rank including G1, but this rank and IUCN's critically endangered (not yet formally assigned) are not interchangeable. NatureServe's rank calculator, as of August 2012, produced a rank of G1.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: This was a widespread rather common bumblebee that occurred in a variety of habitats including urban areas, which could possibly be refugia now.

Other Considerations: A serious negative factor could be the limited occurrence of this bumblebee from very cold regions which seem to be providing refugia for Bombus (Bombus) terricola and B. (B.) occidentalis. However B. affinis does not appear to be persisting in places like New England and in the Appalachians where they formerly overlapped and B. terricola persists, and in some places seems to be recovering. However only B. terricola occurred widely in Canada. B. (B.) affinis barely entered extreme southern Ontario and Quebec. Neither species apparently persists in what are among the warmest parts of the range of B. terricola in southernmost Ontario or Ohio. The persistence, so far anyway, of B. (B.) occidentalis in very cold mountain and northern regions of western North America, but not in warmer Pacific coastal and valley areas where it was also common, also suggests species of this subgenus might be more vulnerable in milder climates. Instead limited refugia for B. affinis are in and near northern Illinois, apparently to some extent in relatively urbanized areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 70 to >90%

Comments: The decline from 2002 to 2009 may be around 90% even in range extent (see Evans et al., 2008 and range comments), and there is very little doubt that number of individuals since 2002 has declined by well over 99%. More conservatively the data in Colla and Packer (2008) suggest about a 95% decline in range extent based on their survey of historic and expected sites from Maine and Ontario to Georgia, which produced only a single specimen from Ontario. Williams et al. (2009) assigned this one a substantially higher decline index than any other species in Ontario. Evans et al. (2008) reported it at a few other places in the upper Midwest in 2006-2008, and Sarina Jepsen of the Xerces Society (email to Nicole Capuano, September 2009) reports records near Peoria and Rockford, Illinois in 2009. Documented decline noted in New York by Committee on the Status of Pollinators (2007) book and the species is on the Xerces Society Red List of pollinators. This species was common until about 2001 and has had a decline in range and relative numbers found of substantially more than 90%, probably well over 99% in numbers, since then. However, the species seems to be persisting in a core area in the upper Midwest. The Xerces Society has records for 2012 from several places each in Illinois (including another for the Rockford area), Minnesota, and especially Dane County Wisconsin, and others from those states in 2010 and 2011. There was also one from Cape Cod, Massachusetts in 2009, and one near Philadelphia in 2007.

Global Long Term Trend: Decline of >90%

Comments: Same as short term. There is little evidence of decline prior to about 2002.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the 1970s, Bombus affinis was among the more common and widespread bumblebee species in eastern North America. Dramatic declines were noted by the mid-1990s in both Canada and the United States. In Canada, extensive targeted searches from 2005 to 2009 detected just three individuals (one in 2005 and two in 2009). Similar population crashes have been observed in the Colla 2010 and references therein)

According to an analysis by Cameron et al. (2011), the relative abundances of four North American bumblebee species have declined by up to 96% and their geographic ranges have contracted by an estimated 23% to 87%, some within a span of two decades. In the recent large-scale bumblebee survey carried out by Cameron et al., which included the capture and identification of nearly 17,000 individuals (most of which were released), only 22 B. affinis individuals were found, and although this species was once found throughout the eastern United States and northern Midwest, individuals were detected at just three locations in Illinois and one in Indiana (yielding an estimated range reduction of 87%).

Grixti et al. (2009) found that bumblebee species richness in Illinois (U.S.A.) declined substantially during the middle of the century (1940 to 1960). Four species were locally extirpated: B. borealis, B., B. terricola and B. variabilis. The ranges of B. affinis, B. fraternus, B. pensylvanicus and B. vagans have also decreased dramatically in Illinois. The major decline in the Illinois bumblebee fauna coincided with large-scale agricultural intensification in Illinois, suggesting one likely factor driving bumblebee declines.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Very high - high

Comments: Like other severely declining bumblebees the main cause is thought to be pathogen spillover of an especially virulent strain of the imported microsporidian (Nosema bombi) and an imported protozoan parasite (Crithidia bombi) from domesticated bumblebees (Bombus impatiens, B. occidentalis) that were reared in Europe and returned to the USA for greenhouse pollination (e.g. Committee on Status of Pollinators, 2007, Colla and Packer, 2008, Evans et al., 2008 and references reviewed in all). While effects of N. bombi are sub-lethal and sometimes quite mild for B. impatiens and some other bumblebees, impacts to subgenus Bombus appear to be severe. The mite Locustacarum buckneri and the honeybee deformed wing virus may also be contributing to decline. There are probably other threats in some places such as land use changes and other forms of habitat loss, changes in nectar flora etc. A potentially serious threat might be novel pesticides especially new persistent neonicotinoids (Colla and Packer, 2008), but more evidence is needed, and this seems inconsistent with findings that some bumblebee species are stable or increasing. The consensus seems to be that the above pathogens and parasites, perhaps especially an introduced Nosema strain, are probably the main causes of the very recent drastic decline. However, Sokolova et al. (2010) suggest there may also be very closely related native North American Nosema, and that is among the plausible explanations for the finding of Koch (2011) of high levels of parasitism of B. (B.) occidentalis in places in Alaska where that bumblebee is still very common. A plausible worst case scenario some or all North American species of subgenus Bombus could be extinct within a decade or two, and one (B. franklini) may be already. Leif Richardson (pers. comm. to N. Capuano, January 2010) suggests B. affinis "is adapted to a fairly narrow range of climate conditions-seasonality, precipitation, temperature" so impact from climate change is more plausible for this species than most North American bumblebees (see Williams and Osborne, 2009). Its persistence near the middle of its overall range would be consistent with narrow tolerances, and the latitudinal range is rather narrow westward. However, B. affinis ranged over a substantial range of climates east of the Appalachians, from cool central Maine, about 45° North, where the July mean is 21° C, and the mean is 20° C or higher for only about two months, to the hot summers of southern New Jersey and Washington D.C. (38-39° North) where July means are 25-27°C, and the mean is 20°C or higher for over 3.5 months, and occurred to some extent in the North Carolina Piedmont around 36° North where the summer is slightly hotter and about a month longer. However most of the southern range was in the mountains with long, cool, wet summers and climate change, so far, does not seem to be a plausible explanation for the apparent crash of this species at all elevations in the mountains or in the Northeast.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The reasons for the sudden decline of Bombus affinis, a previously common species throughout its large range, are unknown. It has been suggested that, along with other vulnerable North American species in the subgenus Bombus (B. occidentalis, B. terricola, and the possibly extinct B. franklini), the species has suffered from introduced diseases transmitted from managed bumblebee colonies used for greenhouse pollination. In addition, habitat loss and the widespread use of certain pesticides likely represent significant threats. (Evans et al. 2008; Colla 2010)

A variety of circumstantial evidence supports the hypothesis that at least some recent bumblebee declines in North America have been driven or exacerbated by the spread of Nosema bombi, an obligate intracellular microsporidian fungal parasite found commonly in bumblebees throughout Europe, via commercial bumblebee rearing facilities that introduced this pathogen from Europe. Pathogenic effects of N. bombi may vary depending on the host species and reproductive caste, but they may include reductions in both colony growth and individual life span and fitness. Further research will be necessary to clarify the role of pathogens in bumblebee declines. (Cameron et al. 2011 and references therein) Based on a combination of modeling, laboratory experiments, and literature review, Otterstatter and Thomson (2008) found strong support for the hypothesis that spillover of Crithidia bombi (a destructive internal trypansomatid protozoan parasite) from bumblebees reared commercially to pollinate greenhouse crops has contributed to the ongoing decline of wild Bombus in North America. Wild bumblebees may also be negatively impacted by the spread of the bumble bee tracheal mite Locustacarus buchneri to wild populations from commercially reared colonies (Evans et al. 2005 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: None. No occurrences appropriately protected and managed

Comments: It is probably not possible to protect any occurrence from pathogen spillover.

Needs: Uncertain but in a plausible worst case scenario captive breeding might be needed. If stable populations are found somewhere, importation of bumblesbees from elsewhere should be prevented.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bombus affinis

The rusty-patched bumblebee (Bombus affinis) is a bumblebee in the subfamily Apinae. Its historical range in North America has been throughout the east and upper Midwest of the United States,[2] north to in Ontario, Canada, where it is considered "species at risk",[3] east to Quebec, south to Georgia, and west to the Dakotas.[3] It has been reduced to an estimated 87% of it original population.[2]

As its name suggests, it has a rusty-coloured patch bordered by yellow on the first half of its abdomen. It is medium- to large-sized bumble bee with an annual lifecycle.[3] It is an excellent pollinator of wildflowers, cranberries, and other important crops, including plum, apple, alfalfa, and onion.[2]

Until the 1980s, it was one of the most common species of bumblebee in southern Ontario. Since then, the species has had a drastic decline and is now difficult to find in its normal range. The only locality within Ontario where the rusty-patched bumblebee has been seen in the last five years is Pinery Provincial Park (Lambton County) despite widespread surveys in Ontario. The Ontario Ministry of Natural Resources has begun a recovery project aimed at protecting the species and critical habitats centred in Pinery Provincial Park.[3] These threats have been proposed as the cause of population decline: pathogen spillover from other species, pesticide use, and habitat fragmentation and loss.[3] Surveys from 2001-2008 have located bombus affinis populations only in Illinois, Iowa, Maryland and Southern Ontario.[2]

References[edit]

  1. ^ "Bombus affinis". Biolib.cz. Retrieved 18 Sep 2013. 
  2. ^ a b c d Rusty-patched Bumble Bee, Xerces Society
  3. ^ a b c d e "Rusty-patched Bumble Bee (Bombus affinis) in Ontario Ontario Recovery Strategy Series". Recovery strategy prepared under the Endangered Species Act, 2007. Ministry of Natural Resources. 2011. Retrieved 8 August 2012. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Bombus

Williams et al. (2012) further demonstrate the distinctiveness of this species which has never been seriously questioned.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!