Overview

Distribution

Bombus ashtoni is found in tropical and temperate zones, most notably in North America, north of Mexico.

Biogeographic Regions: neotropical (Native )

  • Carpenter, F. 1997. Pp. 231-239 in McGraw-Hill Encyclopedia of Science and Technology, Vol. 9, 8th Edition. The Lakeside Press: R.R. Donnelley and Sons Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (Unknown) The historic range was at least New Brunswick south to New Jersey, west across the upper Midwest (e.g. Ohio), to at least South Dakota (Johnson, 2009), and in southern Canada to Saskatchewan northwest well into Alaska. It may have been especially common in the Northeast. Grixti et al. (2008) do not report any records of this species from Illinois. In Quebec, it was last observed in 2001 (Savard, 2009). The current range is not really known but Leif Richardson (pers. com. to Nicole Capuano, January 2010) pointed out that the Discover Life website has a 2003 specimen record from Wasilla, Alaska, apparently the most recent anywhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Bombus ashtoni is terrestrial and polymorphic (indivuduals may be of different sizes). Females are smaller than their host queens. (Fisher and Sampson, 1992).

Bombus ashtoni has two pairs of membranous wings with reduced venation. The hind pair is smaller than the front pair, and both pairs of wings are joined by a row of hamuli or tiny hooks (Krombein, 1997).

Mouthparts are formed for biting. Mouthparts consist of paired mandibles and a labiomaxillary complex formed from membranous connections between the maxillae and the labium. The mandibular, salivary, Dufour's, and venom glands are long and round. In females, venom glands are extremely long and convoluted. B. ashtoni have larger mandibles than their hosts, which are shortened but broader at the apex, and lacking a basal keel (Fisher and Sampson, 1992).

Sternites are thickened, and females have no corbiculae (the pollen baskets formed by long curved hairs, on their hind legs). The female ovipositor is longer and broader than that of the host, and it is strongly recurved.

Bombus ashtoni eggs are smaller than host eggs and are narrowed towards the middle (Fisher and Sampson, 1992).

Other Physical Features: ectothermic ; bilateral symmetry ; venomous

  • Fisher, R., B. Sampson. 1992. Morphological Specializations of the Bumble Bee Social Parasite Psithyrus ashtoni (Cresson) (Hymenoptera: Apidae). Canadian Entomologist, 124: 69-77.
  • Krombein, K. 1997. Pp. 704-713 in McGraw-Hill Encyclopedia of Science and Technology, Vol. 8, 8th Edition. The Lakeside Press: R.R. Donnelley and Sons Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Bombus ashtoni parasitize closely related species, such as Bombus affinis and Bombus terricola, and reside in the nests of these bumblebees (Fisher, 1984). Bombus nests are found in the ground and in deserted bird and mouse nests (Carpenter, 1997).

Habitat Regions: tropical ; terrestrial

  • Fisher, R. 1984. Evolution and host specificity: a study of the invasion success of a specialized bumblebee social parasite. Canadian Journal of Zoology, 62: 1641-1644.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Females eat the eggs laid by the host queen (Fisher, 1987). Bombus ashtoni get carbohydrates from the host resources, presumably stored nectar and pollen.

Animal Foods: eggs; insects

Plant Foods: nectar; pollen

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

To the extent that these animals interfere with the food supply and reproduction of their hosts, they impact those species of Bombus negatively.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Flowering Plants Visited by Psithyrus ashtoni in Illinois

Psithyrus ashtoni Cresson: Apidae (Bombini), Hymenoptera
(observations are from Reed, Davis, and Catling)

Asteraceae: Oligoneuron rigidum sn (Re), Solidago speciosa sn (Re); Lamiaceae: Pycnanthemum virginianum sn (Re); Orchidaceae: Cypripedium acaule exp (Dv), Spiranthes romanzoffiana sn (Ct)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 0 to >300

Comments: If extant at all, most likely so in Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Little is known about their communication habits.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Bombus ashtoni undergoes complete metamorphosis and passes through egg, larval, and pupal states. All members of this species have reproductive capabilities.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males are reared before females, especially since males establish flight territories and are long-lived. This means that males are capable of mating more than once. The sex ratios of these social parasites are found to favor females (Fisher, 1987).

Reproduction is short in duration. Males are produced from unfertilized eggs and females are produced from fertilized eggs (Krombein, 1997). Females use wax from the destroyed host egg cells to construct their own egg cells. Eggs are laid near the center of the comb and are distinguishable from host eggs by their rough edges. There is no worker caste (Fisher, 1987).

Bombus ashtoni bees rear no workers, so they rely on host workers to assist them in rearing offspring. Because of this, females have decision-making processes similar to their hosts regarding the number of workers needed and how best to maintain reproductive control over them. The methods by which they determine how many workers are needed and when to reproduce are poorly understood.

The earlier B. ashtoni are introduced into a host nest, the longer they will wait before laying their eggs. The eggs are laid during the worker growth phase of colony development. The result is a reduced number of workers reared in the parasitized nests. Replacement of host eggs with parasite eggs is a gradual process, so an overlap between colony investment in Bombus workers and Psithyrus reproductives exists.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous ; sperm-storing ; delayed fertilization

Females guard egg cells until the eggs hatch. They do this by pushing host worker bees away from the cells and by mauling host bees. Mauling occurs when the host queen has lost dominance or is removed. The host bee is grasped from above, held close to the underside of the parasite's abdomen, and is released. The ability to guard the eggs is decreased as the number of parasite eggs increase. The result is the loss of parasite brood. B. ashtoni females attempting to maintain a dominant egg-laying position after the queen has lost dominance face animosity by the laying workers. Also, females do not guard the developing larvae.

Parental Investment: pre-hatching/birth (Provisioning: Female); pre-independence (Protecting: Female)

  • Fisher, R. 1987. Queen-worker conflict and social parasitism in bumble bees (Hymenoptera:Apidae). Animal Behaviour, 35: 1026-1036.
  • Krombein, K. 1997. Pp. 704-713 in McGraw-Hill Encyclopedia of Science and Technology, Vol. 8, 8th Edition. The Lakeside Press: R.R. Donnelley and Sons Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus ashtoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTATATGATCTGGAATAATTGGATCTTCAATAAGAATAATAATCCGAATAGAATTAAGTCATCCAGGAATATGAATTAATAATGACCAAATTTATAATTCCATAATTACAAGTCATGCTTTTTTAATAATTTTTTTTATAGTTATACCATTTTTAATTGGTGGATTTGGAAATTACCTAATTCCATTAATACTAGGATCTCCTGATATAGCATTCCCACGACTAAATAACTTAAGATTTTGACTTTTACCTCCATCATTAATAATATTAATATTTAGAAATTTATTTACTCCAAATACTGGAACAGGTTGAACAATCTATCCTCCTTTATCTTCTTATCTATTCCATTCATCACCTTCAATTGACTTAGCAATTTTTTCTCTTCATATAACAGGAATCTCCTCAATTATTGGTTCATTAAACTTTATAGTTTCAATTATAATAATAAAAAATTATTCATTAAACTTTGATCAAATCAATCTATTCTCCTGATCAGTATGTATTACTGTAATTTTATTATCTCTATCTTTACCTGTTTTAGCAGGAGCAATTACAATATTATTATTTGATCGAAATTTCAATACATCATTCTTTGATCCTATAGGAGGAGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bombus ashtoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

This species is in no danger and has no special status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NH - Possibly Extirpated

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GH - Possibly Extinct

Reasons: This recently widespread and fairly common cuckoo bumblebee had not been found since before 2000, despite substantial efforts to find it (Evans et al., 2008) but has turned up in Alaska as recently as 2003 according the Discover Life Website's range map and in Quebec in 2001 (Savard, 2009). Otherwise in the current century, Savard (2009) reports 15 as recently as 2001-2002 in Quebec but zero since then. Notably B. (P.) ashtoni is considered to be possibly extirpated even in Vermont (Rolnick, 2007, Richardson, 2008), despite the fact that Vermont and some other parts of northern New England are among the few places where one of the hosts (Bombus terricola) still turns up with any regularity, even commonly in 2009. However, a nest usurper would obviously be more vulnerable to extirpation or extinction than its hosts, and would be expected to recover more slowly than its hosts. One host, B. terricola, was apparently scarcer in Vermont and other places a few years ago than it is now (2008-2009). It seems unlikely the other definite host, B. affinis, still occurs any place in sufficient numbers to be supporting a nest parasite. Despite documented decline and the near lack of recent records, it is premature to declare Bombus ashtoni extirpated in remote parts of its range, although it is almost certainly extirpated where B. affinis was the main host. In particular, it might reappear in northern New England if B. terricola continues to persist or recover there, and it might still occur in colder remote portions of the Canadian and Alaskan range. For a nest parasite on subgenus Bombus, if the most recent record is as old as 2003 then the possibility that there are no more occurrences has to be considered, which generates a GH from Rank Calculator version 3.1. Bombus declines have not been well documented as far north as Alaska, so one could make a cased for assuming the species probably is still extant, and thus assign GU. There really is no other rank that is appropriate for a recently widespread species that has probably declined by well over 99% in about a decade and has been undetectable anywhere since 2003.

Intrinsic Vulnerability: Highly vulnerable

Comments: An obligate nest parasite that requires substantial populations of bumblebees in the subgenus Bombus.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: The hosts were widespread and common over a large part of North America and in a variety of habitats into the 1990s. This nest parasite seems to have been likewise.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 70 to >90%

Comments: This bee has disappeared, or at least become completely undetectable even with increased effort, in virtually its entire range, with no records anywhere since 2000 according to Evans et al. (2008). Actually this is only true of the US "lower 48", because there is a 2003 specimen from Alaska. Savard (2009) reports 15 records from Quebec as recently as 2001 and zero since. Colla and Packer (2008) document that this decline is statistically significant for Ontario. The decline appears to have been substantially greater than 99% in numbers and maybe even in range. The sole cause of the decline appears to have been major declines in its two known obligate host species Bombus affinis and B. terricola. See documentation for those species regarding causes.

Global Long Term Trend: Decline of >90%

Comments: As far as what is known, this species was very widespread and fairly common until the late 1990s when its host species crashed severely.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Very high - high

Comments: The only meaningful threat now is the severe decline of the host species: Bombus (Bombus) affinis which may be approaching extinction, or perhaps is holding its own in a small area from northern Illinois to Ontario, and B. (B.) terricola which has also declined severely but is persisting or even beginning to recover in Vermont and is extant as of 2009 from western Massachusetts to Nova Scotia (L. Richardson). See documentation under B. (B.) affinis and B. (B.) terricola.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: May not be possible to protect this species.

Needs: The only chance for survival of this species would be by maintaining healthy populations of one of its hosts, most likely in remote boreal regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There is no known economic importance of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is no known economic importance of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bombus ashtoni

Bombus ashtoni is a species of cuckoo bumblebee.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Psithyrus

Although long regarded as a separate species (but questioned by Williams, 1991), on the basis of DNA-sequence data Cameron et al. (2007) have suggested that B. ashtoni might be conspecific with the European B. bohemicus (Williams, 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!