Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Labrador to Alberta in Canada. In the U.S., all of the border states except Ohio, and also South Dakota and formerly northern Illinois.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Bombus borealis in Illinois

Bombus borealis Kirby: Apidae (Bombini), Hymenoptera
(observations are from Reed, Stoutamire, Catling, and Thomson et al.)

Araliaceae: Aralia hispida (TMP); Lamiaceae: Monarda fistulosa (Re), Stachys palustris (Re); Orchidaceae: Cypripedium acaule exp (Stm), Spiranthes romanzoffiana sn (Ct)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus borealis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCAATATGATCAGGAATAATTGGGTCATCAATAAGATTATTAATTCGTATGGAATTAAGAAATCCAGGGGTATGAATTAATAATGATCAAATTTATAATTCTTTAGTTACAAGTCATGCATTTTTAATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGTTTTGGTAATTATTTAATTCCATTAATAATTGGATCTCCTGATATAGCTTTTCCTCGAATAAACAATATTAGATTTTGAATTCTTCCTCCTTCATTAATAATATTATTATTAAGAAATTTATTTACTCCAAATGTAGGAACAGGTTGAACTGTTTATCCTCCTTTATCATCATATTTATTTCATTCATCACCTTCTGTTGATATTGCAATTTTTTCTCTTCATATAACAGGGATTTCTTCTATTATTGGGTCATTAAATTTTATTGTAACAATTATAATAATAAAAAATTATTCATTGAATTATGATCAAATTAATTTATTTTCATGATCTGTATGTATTACAGTAATTTTATTAATTTTATCTTTACCAGTATTAGCAGGAGCTATTACTATATTATTATTTGATCGAAATTTTAATACATCTTTTTTTGATCCAATAGGAGGGGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bombus borealis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: A widespread northern species not known to be declining widely, and known to be common in some places. This species is uncommon in southern parts of the range such as southern Ontario (Colla et al., 2006), but not in apparent decline there (Colla and Packer, 2008). This species will probably prove to be G5, but considering rapid changes in abundance of many bumblebees and limited information on this species, a conservation status rank of G4G5 seems more appropriate.

Intrinsic Vulnerability: Moderately vulnerable

Comments: Queens of this species begin activity later in the season than most others (Grixti et al., 2009), a trait that is shown by Williams et al. (2009) to predispose bumblebees to declines in various parts of the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Except for Grixti et al. 2009 referring mostly to Illinois, which they point out approaches a worst case scenario, and is also on the edge of the range, this species has not been noted as declining. Colla and Packer (2008) found no evidence of decline in southern Ontario, which is also quite far south in the range, and Williams et al. (2009) assign it a very low decline measure there. Turnock et al. (2007) found this bumble bee to be common in Manitoba from 1986-1993.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Probably has disappeared more widely in the Midwest than just Illinois, but this is a small and peripheral part of its range

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Unknown

Comments: Apparently is not being seriously impacted by pathogen spillover. Threats are probably low overall but information is minimal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many (13-40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Subterraneobombus

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!