Overview

Comprehensive Description

General Description

Bombus borealis belongs to the subgenus Subterraneobombus in which females can be distinguished by small ocelli at the supraorbital line (Thorp et al. 1983), while males can be distinguished by spoon-shaped penis valvesthat are turned inwardsas well as the presence of a raised longitudinal keel posteriorly on sternum 6 (Williams et al. 2008)B. borealis individuals have white pile on the face between the eyes;the fifth antennal segment is longer than the fourth or third;the first four abdominal segments are covered with yellow pile, while the remaining segments are black;and the outer surface of the male hind tibia is concave (Franklin 1912).  The length of the queen varies from 15 mm to 19 mm; her wing spread from 32 mm to 39 mm; and the width of the second abdominal segment 8 mm to 9.5 mm. Workers vary in length from 10 mm to 15 mm; in wing spread from 26 mm to 32 mm; and in width of the second abdominal segment from 6.5 mm to 8 mm. Males range in length from 12 mm to 15 mm; in wing spread from 26 mm to 31 mm; and in width of second abdominal segment from 6 mm to 7.5 mm (Franklin 1912).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Labrador to Alberta in Canada. In the U.S., all of the border states except Ohio, and also South Dakota and formerly northern Illinois.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western and eastern neartic regions (Williams 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Prairie habitats with surface and underground nests (Hobbs 1966).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Largely unknown; queens have been observed foraging on wild licorice, Glycyrrhizalepidotaof the family Leguminosae (Hobbs 1966).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Bombus borealis in Illinois

Bombus borealis Kirby: Apidae (Bombini), Hymenoptera
(observations are from Reed, Stoutamire, Catling, and Thomson et al.)

Araliaceae: Aralia hispida (TMP); Lamiaceae: Monarda fistulosa (Re), Stachys palustris (Re); Orchidaceae: Cypripedium acaule exp (Stm), Spiranthes romanzoffiana sn (Ct)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Among the latest of Bombus species to emerge from hibernation and establish nests in spring (Hobbs 1966).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Alford (1975) outlines the life history of Bombus borealis. Newly mated B. borealis queens overwinter beneath the soil litter and emerge from their hibernacula in late spring. Queens are transitory for a time, growing in size while collecting pollen and looking for a suitable nest. Once a suitable nest has been found, the queen constructs an apple sized hollow structure within it. The queen deposits her eggs within a mound of pollen on the floor of the structure; she also constructs a honeypot for storing nectar. Newly hatched larvae begin consuming the pollen mound, requiring the queen to continue provisioning it. The queen periodically incubates her brood by sitting upon it and respiring to generate body heat. The larvae spin cocoons in the final instars, as do the pupa; the cocoons may be re-used later for storage of pollen or nectar. Upon pupation, the emerged adults take nectar from the honey pot. Once the nest consists of the new young workers and the queen it can be considered a social unit and is referred to as a colony. Subsequent generations are produced differently from the first: new eggs are laid in clumps in cells atop the pupating first generation of workers, and workers are now responsible for provisioning of the growing larva and the honey pot. The caste differentiation of each generation varies throughout the year, with the first generations containing all workers, followed by a worker/male split, followed by mostly males, followed by a male/queen split, followed by mostly queens. The factor initiating queen production has not been established but it appears the colony must reach a size capable of maintaining nest temperatures and food stores before queens are produced. Young queens remain in the colony and will mate during their first week. Males leave the hive and do not return; they establish a methodical flight path and mate with encountered queens. Hobbs (1966) reported that males of B. borealis will attempt to mate with queens in the nest, a behaviour seen in select other Bombus subgenera. Only the newly mated queens will overwinter in hibernacula; males, founder queens, and all workers perish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus borealis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCAATATGATCAGGAATAATTGGGTCATCAATAAGATTATTAATTCGTATGGAATTAAGAAATCCAGGGGTATGAATTAATAATGATCAAATTTATAATTCTTTAGTTACAAGTCATGCATTTTTAATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGTTTTGGTAATTATTTAATTCCATTAATAATTGGATCTCCTGATATAGCTTTTCCTCGAATAAACAATATTAGATTTTGAATTCTTCCTCCTTCATTAATAATATTATTATTAAGAAATTTATTTACTCCAAATGTAGGAACAGGTTGAACTGTTTATCCTCCTTTATCATCATATTTATTTCATTCATCACCTTCTGTTGATATTGCAATTTTTTCTCTTCATATAACAGGGATTTCTTCTATTATTGGGTCATTAAATTTTATTGTAACAATTATAATAATAAAAAATTATTCATTGAATTATGATCAAATTAATTTATTTTCATGATCTGTATGTATTACAGTAATTTTATTAATTTTATCTTTACCAGTATTAGCAGGAGCTATTACTATATTATTATTTGATCGAAATTTTAATACATCTTTTTTTGATCCAATAGGAGGGGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bombus borealis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: A widespread northern species not known to be declining widely, and known to be common in some places. This species is uncommon in southern parts of the range such as southern Ontario (Colla et al., 2006), but not in apparent decline there (Colla and Packer, 2008). This species will probably prove to be G5, but considering rapid changes in abundance of many bumblebees and limited information on this species, a conservation status rank of G4G5 seems more appropriate.

Intrinsic Vulnerability: Moderately vulnerable

Comments: Queens of this species begin activity later in the season than most others (Grixti et al., 2009), a trait that is shown by Williams et al. (2009) to predispose bumblebees to declines in various parts of the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Of concern, populations appear to be declining (Grixti et al. 2009).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Except for Grixti et al. 2009 referring mostly to Illinois, which they point out approaches a worst case scenario, and is also on the edge of the range, this species has not been noted as declining. Colla and Packer (2008) found no evidence of decline in southern Ontario, which is also quite far south in the range, and Williams et al. (2009) assign it a very low decline measure there. Turnock et al. (2007) found this bumble bee to be common in Manitoba from 1986-1993.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Probably has disappeared more widely in the Midwest than just Illinois, but this is a small and peripheral part of its range

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Unknown

Comments: Apparently is not being seriously impacted by pathogen spillover. Threats are probably low overall but information is minimal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many (13-40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Subterraneobombus

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!