Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species is widespread in Europe and Northern Asia, and reaches eastward across Alaska and Canada to Hudson Bay.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus sylvestris takes over nest of Bombus jonellus
Other: minor host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bombus jonellus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Bombus jonellus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTTGGAAATTATTTAATTCCACTAATATTAGGATCACCTGATATAGCATTTCCACGAATAAATAATATTAGATTTTGATTACTTCCTCCATCTCTATTTTTATTACTTTTAAGAAATTTATTTACACCAAATGCAGGAACAGGATGAACTGTATATCCTCCTTTATCATCTTATATATTTCATTCATCTCCTTCTATTGATATTGCAATCTTTTCTTTACATATTACAGGAATTTCATCAATCATTGGATCTCTAAATTTTATTGTAACAATTATAATAATAAAAAATTTTTCATTAAATTATGATCAAATTAATTTATTTTCATGATCAGTATGTATTACAGTAATATTATTAATTTTATCATTACCAGTTTTAGCAGGAGCAATTACTATACTTCTTTTCGATCGAAATTTTAATACATCTTTTTTCGATCCAATAGGAGGAGGTGATCCAATCCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTCTTCCCGGATTTGGATTAATTTCTCAGATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGAAACTTAAGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGGTTTATTGTTTGAGCTCATCATATATTTACTGTTGGTTTAGATGTTGATACTCGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: G5 is an inspection rank, based primarily on the enormous distribution, much of it in sparsely inhabited far northern regions of Russia, Alaska and Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Unknown

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombus jonellus

Bombus jonellus is a species of bumblebee that bears the common name heath humble-bee or small heath bumblebee. It is widely distributed in Europe and northern Asia,[2] as well as northern North America.[1]

Description[edit source | edit]

A fairly small bumblebee, with body lengths around 16 millimetres (0.63 in) (queen), 12 millimetres (0.47 in) (worker) and 12 millimetres (0.47 in) (male).[3] The queen has an average wingspan of 29 millimetres (1.1 in). The face and proboscis (tongue) are short. Females (queens and workers) have a predominantly black abdomen with a yellow collar, the first and sometimes second terga yellow, and a white tail. The face is black, occasionally with a patch of yellow fur on the top. Males are similar, but with more yellow; the yellow collar continues on the ventral side, the two first terga are always yellow, and there is much more yellow fur on the face. However, there are darker forms of the females, as well as forms (sometimes considered subspecies) that differ in the amount of yellow in the fur, and with brownish hairs on the white tail. Among these are B. jonellus hebridensis (which is endemic to the Hebridean islands of Scotland[4]), B. jonellus monapiae and. B. jonellus vogtii. On the Orkney and the Hebrides a form exists where the males have red tails instead of white.[5]

Ecology[edit source | edit]

Bombus jonellus is found in gardens, meadows as well as on heath and moorland.[3] The bumblebee visits various food sources as clover, bird's-foot trefoil, cowberry, thistles and many others.[5]

The nest, which at most can contain 50 to 120 workers, can be situated both above ground and underground. When the climate permits, as in southern England, this species can have two broods a season. A study in northern Sweden shows that the males, when patrolling for young queens, do so at tree-top level marking twigs and leaves with pheromones to attract the queens.[5]

Distribution[edit source | edit]

Bombus jonellus is present in most of Europe and a large part of northern Asia. In the west it is common from Iceland in the north to Cantabrian Mountains in northern Spain. It is found beyond the Arctic Circle in Scandinavia and Russia, where it is continuous north of 55ºN, more uneven south of it. In southern Europe, the distribution too is patchy, and restricted to the mountains. In Asia it reaches the Gulf of Anadyr on the Pacific.[2] In United Kingdom it is common in the south-east, in East Anglia, northern Scotland including the Hebrides, Orkney and Shetland.[5] It is also found in Canada east to Hudson Bay and Alaska.[6]

References[edit source | edit]

  1. ^ a b "Bombus jonellus". Integrated Taxonomic Information System. 
  2. ^ a b Pierre Rasmont. "Bombus (Pyrobombus) jonellus (Kirby, 1802)". Université de Mons. Retrieved 31 December 2012. 
  3. ^ a b "Less common species of bumblebee found in the UK". Bumblebee.org. Retrieved 24 December 2012. 
  4. ^ Thompson, Francis (1968) Harris and Lewis, Outer Hebrides. Newton Abbot. David & Charles. ISBN 0-7153-4260-6 p. 21
  5. ^ a b c d Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 333–337. ISBN 0007174519. 
  6. ^ "Bombus". Natural History Museum, London, UK. 2013. Retrieved 5 January 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Pyrobombus

Bombus alboanalis has been regarded both as a separate species (Franklin, 1913; Frison, 1927) and as conspecific with either B. frigidus (Hurd, 1979; Poole, 1996) or B. jonellus (Williams, 1991 [as B. jonellus from Western Canada]; Scholl et al. 1995). In this database we are following Williams (2008) and treat alboanalis as conspecific with jonellus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!