Ecology

Associations

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus bohemicus takes over nest of Bombus lucorum

Animal / sequestrates
female of Psithyrus bohemicus takes over nest of Bombus magnus

Animal / sequestrates
female of Psithyrus bohemicus takes over nest of Bombus cryptarum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus bohemicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAAATTACCTAATTCCATTAATACTAGGATCTCCTGATATAGCATTCCCACGACTAAATAACTTAAGATTTTGACTTTTACCTCCATCATTAATAATATTAATATTTAGAAATTTATTTACTCCAAATACTGGAACAGGTTGAACAATCTATCCTCCTTTATCTTCTTATCTATTCCATTCATCACCTTCAATTGACTTAGCAATTTTTTCTCTTCATATAACAGGAATCTCCTCAATTATTGGTTCATTAAACTTTATAGTTTCAATTATAATAATAAAAAATTATTCATTAAACTTTGATCAAATCAATCTATTCTCCTGATCAGTATGTATTACTGTAATTTTATTATCTCTATCTTTACCTGTTTTAGCAGGAGCAATTACAATATTATTATTTGATCGAAATTTCAATACATCATTCTTTGATCCTATAGGAGGAGGTGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTCTTCCGGGATTTGGATTAATTTCACAAATAATTATAAACGAAAGAGGAAAAAAAGAAACTTTTGGAAATTTAAGAATAATTTATGCAATACTAGGTATTGGATTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTTGGAATAGATGTAGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bombus bohemicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombus bohemicus

Bombus bohemicus is a species of cuckoo bumblebee, that can be found in most of Europe with exception of the southern Iberian Peninsula and Iceland.[1]

Contents

Description

A fairly small bumblebee (the length of the queen is around 18 millimetres (0.71 in)) with a round face and a short proboscis (tongue). The male is quite smaller than the queen. The bumblebee has a pale yellow collar, often yellow hairs on the first tergite (abdominal segment), pale yellow sides on the third tergite and a white tail on an otherwise almost black abdomen. Males in northern Scotland sometimes have yellow tails instead of white.[2]

Ecology

The species is a cuckoo bumblebee, having Bombus lucorum as a host, killing or subduing its queen and taking over its nest.[3]

Bombus bohemicus feeds on various flowering plants, as, among others, tyme, scabious, marsh and thistles for the male, sallow, dandelion, clover, bilberry and raspberry for the female.[2]

Distribution

The bumblebee is distributed through most of Europe from beyond the Arctic Circle to northern Spain, and from the British Isles in the west to eastern Russia. It is also found in Turkey.[1] In Britain it is common in the south-western peninsula, northern England, and Scotland. In the south-eastern part, however, it is rare (with exception of the East Anglian brecks).[2]

References

  1. ^ a b Pierre Rasmont. "Bombus (Psithyrus) bohemicus (Seidl, 1837)". Université de Mons. http://zoologie.umh.ac.be/hymenoptera/pagetaxon.asp?tx_id=3054. Retrieved 2 January 2013.
  2. ^ a b c Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 407-410. ISBN 0007174519.
  3. ^ "Bombus bohemicus Seidl, 1838". Biolib.cz. http://www.biolib.cz/en/taxon/id70370/. Retrieved 2 January, 2013.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!