Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bombus hypnorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bombus hypnorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTCGGAAATTACTTAATTCCTTTAATATTAGGATCCCCTGATATAGCTTTCCCACGAATAAATAATATTAGATTTTGATTACTTCCTCCATCTCTTCTAATACTTCTTTTAAGAAATTTATTTACCCCAAATGTTGGCACTGGATGAACTGTTTATCCTCCTTTATCATCATATATATTTCATTCATCACCTTCTATTGATATTGCAATTTTTTCATTACATATAACTGGAATTTCTTCAATTATTGGATCATTAAATTTTATTGTAACTATTATATTAATAAAAAATTTTTCATTAAATTATGATCAAATTAATTTATTCTCTTGATCAGTTTGTATTACAGTAATATTATTAATTTTATCTTTACCAGTTTTAGCAGGAGCAATTACTATACTTCTTTTTGATCGAAATTTTAATACATCTTTCTTCGATCCAATAGGAGGAGGTGATCCGATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTCTACCTGGATTTGGATTAATTTCTCAAATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGAAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCACACCATATATTTACTGTTGGATTAGATGTTGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bombus hypnorum

Bombus hypnorum, the tree bumblebee or new garden bumblebee, is a species of bumblebee common on the European continent and parts of Asia. It has recently spread to United Kingdom and Iceland.

Description[edit]

Bombus hypnorum has a short proboscis and a rounded head. The thorax is usually of a uniformly ginger colour (but examples with a darker, or even black thorax occur), the abdomen is black-haired and the tail is always white. In workers, the first tergite (abdominal segment) is black-haired, but a proportion of males may have ginger hairs intermixed with the black hair, both on the face and on the first abdominal tergum. On the European continent, individuals with extended yellow coloration exist.[1] Workers are often (but not always) small, drones are much bigger, and the queens vary in size.[2]

Distribution[edit]

B. hypnorum is a common bumblebee species in continental Europe and northern Asia, from northern France to Kamchatka in the east, and from the Pyrenees to the mountains in northern Europe. It is not found, though, in the Mediterranean, the Balkans, or the steppes of eastern Europe, only in the mountains of the Iberian Peninsula and not south of Tuscany in Italy.[3] The bumblebee was first observed in United Kingdom on 17 July 2001 close to the village of Landford in Wiltshire, and has since been spreading widely.[1] In August 2008, B. hypnorum was found in Iceland, and queens have been found each year since. It likely will continue to stay in Iceland and prosper in close living with humans near dense settlements, i.e. Reykjavík, but will most likely not venture into the more rural parts of Iceland.[4][5]

Habitat[edit]

The bumblebee often lives near human settlements. It prefers to build its nest above ground and often inhabits bird boxes.[6] The nest is quite large, with 150 workers or more (according to some authorities up to 400). The species is a pollen storer; it stores pollen in separate cells and feeds each larva individually, instead of storing the pollen directly in the larval cells. It visits an enormous range of flowering plants such as Rhododendron, cherry, grape hyacinth and, in the north, Vaccinium.[1] It is an important visitor to raspberry (Rubus idaeus) and bramble (Rubus fruticosus agg.).

Breeding[edit]

The species has a short breeding cycle, with queens emerging early, usually in March. The first cycle is completed from mid-May to early July (depending on the season). A smaller second generation is produced in late summer in favourable years.

Behaviour[edit]

The tree bumblebee is generally quite docile, but if disturbed, it can defend its nest proactively and it has been known to sting people whom it perceives as a threat.

References[edit]

  1. ^ a b c Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 348–350. ISBN 0007174519. 
  2. ^ Bumblebee conservation: Introducing the tree bumblebee by Clive Hill
  3. ^ Pierre Rasmont. "Bombus (Pyrobombus) hypnorum (L., 1758)". Université de Mons. Retrieved 12 January 2013. 
  4. ^ Icelandic Ministry for the Environment News of arrival
  5. ^ Icelandic Ministry for the Environment Article on Bombus hypnorum
  6. ^ Anon. "Common bumblebees:Tree bumblebee Bombus hypnorum". Bumblebee Conservation Trust. BCT. Retrieved 30 June 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!