Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus hypnorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTCGGAAATTACTTAATTCCTTTAATATTAGGATCCCCTGATATAGCTTTCCCACGAATAAATAATATTAGATTTTGATTACTTCCTCCATCTCTTCTAATACTTCTTTTAAGAAATTTATTTACCCCAAATGTTGGCACTGGATGAACTGTTTATCCTCCTTTATCATCATATATATTTCATTCATCACCTTCTATTGATATTGCAATTTTTTCATTACATATAACTGGAATTTCTTCAATTATTGGATCATTAAATTTTATTGTAACTATTATATTAATAAAAAATTTTTCATTAAATTATGATCAAATTAATTTATTCTCTTGATCAGTTTGTATTACAGTAATATTATTAATTTTATCTTTACCAGTTTTAGCAGGAGCAATTACTATACTTCTTTTTGATCGAAATTTTAATACATCTTTCTTCGATCCAATAGGAGGAGGTGATCCGATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTCTACCTGGATTTGGATTAATTTCTCAAATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGAAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCACACCATATATTTACTGTTGGATTAGATGTTGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bombus hypnorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombus hypnorum

Bombus hypnorum, the tree bumblebee or new garden bumblebee, is a species of bumblebee that is common on the European continent and parts of Asia. It has recently spread to United Kingdom and Iceland.

Contents

Distribution

Bombus hypnorum is a common bumblebee species in continental Europe and northern Asia, from northern France to Kamchatka in the east, and from the Pyrenees to the mountains in the northern Europe. It is however not found in the Mediterranean, the Balkans or the steppes of eastern Europe, only in the mountains of the Iberian peninsula and not south of Tuscany in Italy.[1] The bumblebee was first observed in United Kingdom on the 17 July 2001 close to the village of Landford in Wiltshire, and has since been spreading to the south and south-east.[2] In August 2008, Bombus hypnorum was found in Iceland, and queens have been found each year since. It is likely it will continue to stay in Iceland and prosper in close living with humans near dense settlements, i.e. Reykjavík, but will most likely not venture into the more rural parts of Iceland.[3][4]

Description

Bombus hypnorum has a short proboscis (tongue) and an rounded head. The thorax is uniformly ginger, the abdomen black and the tail white. Usually the first tergite (abdominal segment) has yellow colouration, at least on its sides. Males may have yellow hairs intermixed with the black fur on their faces. On the continent individuals with extended yellow colouration exist.[2]

Ecology

The bumblebee often lives near human settlements. The nest is quite large, 150 workers or more (according to some authorities up to 400). The species is a pollen storer, i.e. it stores pollen in separate cells and feeds each larva individually, instead of storing the pollen directly in the larval cells. It visits flowering plants as Rhododendron, cherry, grape hyacinth and, in the north, Vaccinium.[2]

The tree bumblebee defends its nest in a very pro-active manner. If disturbed, a large number of very aggressive workers emerge from the entrance to defend the nest. They will fly at high speed around the entrance to the nest, in order to scare away possible attackers. In this state, they may well sting unprovoked. For this reason, the tree bumblebee might end up in conflict with humans if it establishes its nest in human buildings. However, if left undisturbed, the tree bumblebee is quite peaceful.

Photo gallery

References

  1. ^ Pierre Rasmont. "Bombus (Pyrobombus) hypnorum (L., 1758)". Université de Mons. http://zoologie.umh.ac.be/hymenoptera/pagetaxon.asp?tx_id=3045. Retrieved 12 January 2013.
  2. ^ a b c Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 348-350. ISBN 0007174519.
  3. ^ Icelandic Ministry for the Environment News of arrival
  4. ^ Icelandic Ministry for the Environment Article on Bombus hypnorum
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!