Ecology

Associations

Animal / parasitoid / endoparasitoid
solitary larva of Conops vesicularis is endoparasitoid of adult of Bombus muscorum

Animal / parasitoid / endoparasitoid
solitary larva of Physocephala nigra is endoparasitoid of adult of Bombus muscorum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus muscorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAAATTATTTAATTCCTTTAATATTAGGATCACCAGATATAGCATTTCCTCGAATAAATAATATTAGATTTTGAATTTTACCTCCTTCATTAATATTATTATTATTAAGAAATTTATATACACCTAATGTTGGAACAGGTTGAACAGTTTATCCTCCATTATCTTCATATTTATTTCATTCATCACCATCTGTTGATATTGCAATTTTTTCTCTTCATATAACAGGAATTTCTTCTATTATTGGATCTTTAAATTTTATTGTTACAATTATATTAATAAAAAATTATTCTTTAAGTTATGATCAAATTAATTTATTTTCATGATCAGTTTGTATTACTGTAATTTTATTAATATTATCTTTACCTGTTTTAGCTGGAGCAATTACAATATTACTTTTTGATCGAAATTTTAATACATCTTTTTTTGATCCTATAGGAGGTGGTGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGATTAATTTCTCAAATTATTATAAATGAAAGTGGAAAAAAAGAAACTTTTGGAAATTTAAGTATAATTTATGCAATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTTGGATTAGATGTTGATACTCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bombus muscorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bombus muscorum

Bombus muscorum, commonly known as large carder bee or moss carder bee, is a species of bumblebee found in Eurasia.[2]

Description[edit]

Bombus muscorum has an oblong face and a relatively long tongue. The fur on the face, thorax, and abdomen is almost entirely ginger. The second terga (abdominal segment) can, however, have a darker, brownish colouring. In Britain, island forms can have the ginger fur on the body and face intermixed with black hair, as well as an entirely black ventral side. The queen has an average length of 19 mm (0.75 in) and a wingspan of 35 mm (1.4 in),[3] while the length of the worker and male is around 14 mm (0.55 in).[4]

Ecology[edit]

Bombus muscorum inhabits moors, grasslands,[5] and salt marshes, where it builds its nest on or just below ground.[4] The bumblebee collects dry grass and moss to cover the nest.[5] The nest is small, containing fewer than 100 workers.[3]

Its food sources include clover, bird's-foot trefoil, vetches, and thistles.[3] It usually forages close to its nest, normally less than 500 m.[6]

Distribution[edit]

The species has a wide distribution in a large part of Eurasia, from Ireland in the west to Mongolia in the east, and from middle Scandinavia and Vyborg (Russian Karelia) in the north to Crete in the south. However, it is fairly rare in all its continental locations.[7] In Britain, its distribution is patchy and, except for Scotland, predominantly coastal. Populations are also found on the Isle of Man, the Hebrides, Orkney, and Shetland.[3]

References[edit]

  1. ^ "Bombus muscorum". Integrated Taxonomic Information System. 
  2. ^ "Map of Bombus muscorum". Discover Life (American Museum of Natural History). Retrieved 24 December 2012. 
  3. ^ a b c d Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 384–388. ISBN 0007174519. 
  4. ^ a b "Less common species of bumblebee found in the UK". Bumblebee.org. Retrieved 24 December 2012. 
  5. ^ a b "BUMBLEBEE - MOSS CARDER - WESTERN ISLES". Virtual Hebrides. Retrieved 24 December 2012. 
  6. ^ Goulson, Dave (2010). "Chapter 6: Foraging Economics". Bumblebees: behaviour, ecology, and conservation. Oxford, UK: Oxford University Press. p. 95. ISBN 9780199553075. 
  7. ^ P. Rasmont. "Bombus (Thoracobombus) muscorum (L. 1761)". Université de Mons. Retrieved 24 December 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!