Overview

Brief Summary

Biology

This species creates its nests on the surface, in old mouse runs through grass, in tangles of vegetation or just under the surface of the soil (1) (2). Colonies vary in size, and can contain up to 200 workers (2). Only young queens survive the winter; they establish new nests in spring, laying the first eggs into pots of wax. After hatching, the white larvae are fed on honey and pollen by the queen. When they are fully-grown, the larvae cease to feed and develop into pupae after spinning a protective silk cocoon around themselves. During the pupal stage the larvae undergo complex changes, and develop into adult workers (2).  When the first set of workers are fully developed they take over the foraging duties and care of the brood, and the queen simply lays eggs (1). The workers feed the larvae on pollen and nectar which they gather on groups of hairs on the back legs, known as 'pollen baskets'(1). They gather nectar from long tube-like flowers, with white dead-nettle a firm favourite (2). When the colony reaches its peak, males and new queens are produced (2). Males develop from unfertilised eggs and appear in summer, flying around in search of new queens with which to mate (3). Shortly after mating, the male dies and the newly mated queen searches for a place to hibernate. The colony, together with the old queen, gradually dies, though colonies of this species are the longest-lived of British bees, persisting until October (1)(2). The newly mated queens emerge the following spring, to establish new colonies (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The common carder bumblebee is the only common bumblebee to have a completely ginger thorax. Although the abdomen also tends to be gingery, it is more variable in colour, and can be greyish or red (2). The coat tends to be rather scruffy-looking and is short (1). This species has a fairly long tongue and males can be distinguished from females as they have longer antennae (1). Carder bumblebees earn this name from their habit of combing material together (carding) to create a covering for the cells containing the larvae (2). The scientific name pascuorum is derived from the Latin pascuum and means of the pastures (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

This species is widespread in Britain (2). Two forms occur in Britain; the ranges of these forms overlap in the north of England and northern Wales and they interbreed in these areas (1). This species is also found in mainland Europe (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Found in grassy habitats and gardens (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Plant / pollenated
adult of Bombus pascuorum pollenates or fertilises flower of Spiranthes romanzoffiana
Other: major host/prey

Animal / parasitoid / endoparasitoid
solitary larva of Physocephala rufipes is endoparasitoid of adult of Bombus pascuorum

Animal / sequestrates
female of Psithyrus campestris takes over nest of Bombus pascuorum

Animal / parasitoid / endoparasitoid
solitary larva of Sicus ferrugineus is endoparasitoid of adult of Bombus pascuorum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus pascuorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAAATTATTTAATTCCTTTAATATTAGGAGCACCAGATATAGCATTTCCTCGAATAAATAATATTAGATTTTGAATTTTACCTCCTTCATTAATATTATTATTATTAAGAAATTTATTTACACCTAATGTTGGAACAGGATGAACAGTTTATCCTCCATTATCTTCATATTTATTTCATTCTTCACCATCTGTTGATATTGCAATTTTTTCACTTCATATAACAGGAATTTCTTCTATTATTGGTTCTTTAAATTTTATTGTTACTATTATAATAATAAAAAATTATTCATTAAATTATGATCAAATTAATTTATTTTCATGATCAGTATGTATTACTGTAATTTTATTAATTTTATCTTTACCTGTTTTAGCAGGAGCAATTACAATATTACTTTTTGATCGAAATTTTAATACATCTTTTTTTGATCCTATAGGAGGTGGGGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGATTAATTTCTCAAATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGAAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCACATCATATATTTACTGTTGGTTTAGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bombus pascuorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Widespread and fairly abundant (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although this species is not currently threatened in Britain, many British bumblebee species have undergone a worrying decline, largely as a result of changes in agricultural practices leading to a loss of open habitats and important food plants (5). Agricultural changes, such as the widespread switch from hay meadows to silage production have greatly affected bumblebees throughout Britain. Silage is made from grass treated with fertilisers and cut regularly through the year; grasses treated in this way are poor in flowers needed by bees (6). The common carder bumblebee is at risk from mowing and ploughing due to its surface-nesting habits (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Concern over the decline of our bumblebee populations has caused steps to be taken. Research into the habitat requirements and ecology of Britain's native bumblebees is on-going. English Nature has produced a leaflet called “Help Save The Bumblebee…Get More Buzz from Your Garden”, which includes advice on how to make your garden attractive to bumblebees (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombus pascuorum

Bombus pascuorum, the Common Carder-bee, is a species of bumblebee belonging to the family Apidae subfamily Apinae tribus Bombini.

They are present in most of Europe in a wide variety of habitats such as meadows, pastures, waste ground, ditches and embankments, road, field margins, as well as gardens and parks in urban areas and forests and forest edges.

Bombus pascuorum – Lateral view

These bees reach a body length of 15–18 millimetres (0.59–0.71 in)(Queen), 9–15 millimetres (0.35–0.59 in)(worker) or 12–14 millimetres (0.47–0.55 in) (drone). Their wingspan is 28–32 millimetres (1.1–1.3 in) (Queen), 20–28 millimetres (0.79–1.1 in) (worker) or 24–27 millimetres (0.94–1.1 in) (drone).

The thorax is yellowish or reddish-brown. The first 4 abdominal segments have grayish hair, while the fifth and sixth tergite hairs are yellowish or reddish brown. However the species is quite variable in color.

The head is medium long, the snout long, reaching lengths of 13–15 millimetres (0.51–0.59 in) (Queen), 12–13 millimetres (0.47–0.51 in) (worker) and 10–11 millimetres (0.39–0.43 in) (drone).

Queens appear between early April to mid-May, workers at the end of April/early May to mid-October. Young Queens and drones can be found from mid-August to late October. When Queens search for suitable places to nest, they fly just above the vegetation, for example on forest edges, investigating cavities such as holes in the ground or niches in dead wood and grass. The nests can be constructed above ground and underground, preferably in old mouse nests but also in bird nests as well as in barns and sheds.

Nest-building proceeds as follows. The Queen collects moss and grass to form a small, hollow sphere whose walls are partly bonded with wax and sealed off. Within this is formed a large bowl of brown wax of about five millimeters, which is filled with pollen. Thereafter 5 to 15 eggs are deposited, and the cell closed. Another 20 mm-high cup is then filled with nectar, thus serving as its own food reserve for bad weather days. After three to five days the larvae hatch to feed on the pollen. After about a week the larvae are mature.

The adult bees, owing to the initially poor supply situation, are relatively small, reaching only about half the body length of the Queen and lacking functioning ovaries. Later hatching bees are much larger. The additional nesting and brood care is dedicated solely to the Queen, which no longer leaves the nest. From August, rarely before, the first fully developed females, together with drones, are ready. Drones hatch from unfertilized eggs.

In August the pascuorum nest, with a diameter of up to 15–20 centimetres (5.9–7.9 in), reaches a maximum population size from 60 to 150 individuals. Shortly after this peak, the population quickly decreases. With the Queen the entire nest dies, usually in September. Occasionally, individuals survive until October/November. Only the last-hatched females survive, to mate with males. Then they fly in search of a safe place for hibernation.

This polylectic bee feeds on a variety wild flowers, including Nettle (Urticaceae), Genuine Motherwort (Lamiaceae), Himalayan Balsam (Balsaminaceae), Cabbage Thistle, Knapweed (Asteraceae), Vetch, Red and White Clover (Fabaceae), Monkshood (Ranuncolaceae), fruit trees, etc.

Gallery

References

  1. ^ Paul Williams. "Thoracobombus annotated checklist". Bombus: bumblebees of the world. Natural History Museum. Retrieved 18 June 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!