Overview

Comprehensive Description

Bombus pratorum (L., 1761)

Materials

Type status: Other material. Occurrence: occurrenceRemarks: on Campanula barbata L.; recordedBy: S. Bossert ; individualCount: 1 ; sex: 1 female; Location: country: Austria ; stateProvince: Tyrol; locality: Zemmgrund ; verbatimElevation: 2041 m; decimalLatitude: 47.024797 ; decimalLongitude: 11.813171 ; Event: samplingProtocol: manual catch ; eventDate: 07-10-12 ; habitat: alpine meadow

Distribution

Palaearctic ( Williams 1998 , Williams 2014 ).

  • Bossert, Silas (2014): The high alpine bee fauna (Hymenoptera: Apoidea) of the Zillertal Alps, Austria. Biodiversity Data Journal 2, 1115: 1115-1115, URL:http://dx.doi.org/10.3897/BDJ.2.e1115
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Animal / parasitoid / endoparasitoid
solitary larva of Physocephala rufipes is endoparasitoid of adult of Bombus pratorum

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus sylvestris takes over nest of Bombus pratorum
Other: major host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus pratorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTAATTATTTAATTCCATTAATATTAGGATCACCTGATATAGCTTTTCCACGAATAAATAATATTAGATTTTGATTACTTCCTCCATCTCTTCTTATATTACTTTTAAGAAATCTATTTACACCAAATGTAGGAACAGGATGAACTGTATATCCTCCTTTATCATCTTATATATTTCACTCATCCCCTTCAGTTGATATTGCAATTTTTTCATTACATATAACAGGAATTTCTTCAATTATTGGATCTTTAAATTTTATTGTAACTATTATATTAATAAAAAATTTTTCATTAAATTATGATCAAATTAATTTATTTTCTTGATCAGTTTGTATTACAGTAATATTATTAATTCTATCTTTACCAGTTTTAGCAGGAGCAATTACTATACTTCTTTTTGATCGAAATTTCAATACATCTTTTTTTGATCCTATAGGAGGTGGAGATCCAATTTTATATCAACATCTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTCTTCCAGGATTTGGATTAATTTCTCAAATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGAAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTTGGTTTAGATGTTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bombus pratorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Early bumblebee

The early bumblebee or early-nesting bumblebee (Bombus pratorum) is a small bumblebee with a wide distribution in most of Europe and parts of Asia.

Bombus pratorum-02 (xndr).jpg

Description[edit]

The queen is black with a yellow collar (the band around the front of the thorax), another yellow band on the first tergite (abdominal segment), and red colouration on the tail (terga 5 and 6). The male has a wider yellow collar, yellow colouration on both terga 1 and 2, and a red tail, also. The workers are similar to the queen, but often with less yellow colouration; usually the abdominal, yellow band is more or less missing. The head of the bumblebee is rounded, and the proboscis is short.[1] The bumblebee is quite small; the queen has a body length of 15–17 mm (0.59–0.67 in), the worker 10–14 mm (0.39–0.55 in), and the male 11–13 mm (0.43–0.51 in).[2]

Flight period[edit]

It flies early (hence its name), usually from March to July, but in milder climates, as parts of southern England, it can appear as early as February.[1] However, the large earth bumblebee is normally even earlier.[3]

Habitat[edit]

Its habitat is very wide ranging, including fields, parks, scrubland, and sparse forest.[4]

Distribution[edit]

It is found in most of Europe, from the Arctic to the Mediterranean. It is, however, uncommon in the south of the Iberian Peninsula, Italy, and the Balkans. On the steppes of southern Russia and Ukraine, it is totally absent. In Asia, it is found in the mountains of northern Turkey, northern Iran, and uncommonly in Siberia west of the Yenisei River.[5]

It is common in most of the mainland United Kingdom, but less so in north-west of Scotland. It is absent from most Scottish islands, Orkney, and Shetland.[1]

Behaviour[edit]

A second generation is common in warmer climates (as most of England; in Scotland the species usually has only one brood yearly), often established in existing, but declining nests. Colonies rarely contain more than 100 individuals. It is a pollen storer, that is, it stores pollen in wax pots or empty cells and feeds each larva individually, rather than storing the pollen in pockets in the larval cells.[1]

It feeds on flowering plants with short corollae, as white clover, thistles, sage, lavender, Asteraceae, cotoneaster, and Allium.[2]

References[edit]

  1. ^ a b c d Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 338–342. ISBN 0007174519. 
  2. ^ a b "Bombus pratorum, the Early bumblebee". Bumblebee.org. Retrieved 2013-01-24. 
  3. ^ Bombus pratorum The Garden Safari
  4. ^ "Kleine Wald- bzw. Wiesenhummel - Bombus pratorum" (in German). Wildbienen.de. Retrieved 2013-01-24. 
  5. ^ Pierre Rasmont. "Bombus (Pyrobombus) pratorum (L., 1761)". Université de Mons. Retrieved 24 January 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!