Ecology

Associations

Animal / parasitoid / endoparasitoid
solitary larva of Physocephala rufipes is endoparasitoid of adult of Bombus pratorum

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus sylvestris takes over nest of Bombus pratorum
Other: major host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus pratorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTAATTATTTAATTCCATTAATATTAGGATCACCTGATATAGCTTTTCCACGAATAAATAATATTAGATTTTGATTACTTCCTCCATCTCTTCTTATATTACTTTTAAGAAATCTATTTACACCAAATGTAGGAACAGGATGAACTGTATATCCTCCTTTATCATCTTATATATTTCACTCATCCCCTTCAGTTGATATTGCAATTTTTTCATTACATATAACAGGAATTTCTTCAATTATTGGATCTTTAAATTTTATTGTAACTATTATATTAATAAAAAATTTTTCATTAAATTATGATCAAATTAATTTATTTTCTTGATCAGTTTGTATTACAGTAATATTATTAATTCTATCTTTACCAGTTTTAGCAGGAGCAATTACTATACTTCTTTTTGATCGAAATTTCAATACATCTTTTTTTGATCCTATAGGAGGTGGAGATCCAATTTTATATCAACATCTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTCTTCCAGGATTTGGATTAATTTCTCAAATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGAAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTTGGTTTAGATGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bombus pratorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Early bumblebee

The Early Bumblebee or Early-nesting Bumblebee (Bombus pratorum) is a small bumblebee with a wide distribution in most of Europe and parts of Asia.

Bombus pratorum-02 (xndr).jpg

Description[edit]

The queen is black with a yellow collar (the band around the front of the thorax), another yellow band on the first tergite (abdominal segment) and red colouration on the tail (terga 5 and 6). The male has a wider yellow collar, yellow colouration on both terga 1 and 2 and, as the queen, a red tail. The workers are similar to the queen, but often with less yellow colouration; usually the abdominal, yellow band is more or less missing. The head of the bumblebee is rounded, and the proboscis (tongue) is short.[1] The bumblebee is quite small; the queen has a body length of 15–17 millimetres (0.59–0.67 in), the worker 10–14 millimetres (0.39–0.55 in) and the male 11–13 millimetres (0.43–0.51 in).[2]

Flight period[edit]

It flies early (hence its name), usually from March to July, but in milder climates, as parts of southern England, it can appear as early as February.[1] However, the large earth bumblebee is normally even earlier.[3]

Habitat[edit]

Its habitat is very wide ranging, including fields, parks, scrubland and sparse forest.[4]

Distribution[edit]

It is found in most of Europe, from the Arctic to the Mediterranean. It is, however, uncommon in the south of the Iberian peninsula, Italy and the Balkans. On the steppes of southern Russia and Ukraine it is totally absent. In Asia it is found in the mountains of northern Turkey, northern Iran and, uncommonly, in Siberia west of the Yenisei.[5]

It is common in most of the mainland United Kingdom; however less so in north-west of Scotland. It is absent from most Scottish islands, Orkney and Shetland.[1]

Behaviour[edit]

A second generation is common in warmer climates (as most of England; in Scotland the species usually have only one brood yearly), often established in existing, but declining nests. Colonies rarely contain more than 100 individuals. It is a pollen storer, that is, it stores pollen in wax pots or empty cells and feeds each larva individually, rather than storing the pollen in pockets in the larval cells.[1]

It feeds on flowering plants with short corollae, as white clover, thistles, sage, lavender, Asteraceae, cotoneaster and allium.[2]

References[edit]

  1. ^ a b c d Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 338–342. ISBN 0007174519. 
  2. ^ a b "Bombus pratorum, the Early bumblebee". Bumblebee.org. Retrieved 2013-01-24. 
  3. ^ {http://www.gardensafari.net/en_picpages/bombus_pratorum.htm Bombus pratorum] The Garden Safari
  4. ^ "Kleine Wald- bzw. Wiesenhummel - Bombus pratorum" (in German). Wildbienen.de. Retrieved 2013-01-24. 
  5. ^ Pierre Rasmont. "Bombus (Pyrobombus) pratorum (L., 1761)". Université de Mons. Retrieved 24 January 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!